ID: 1059196508

View in Genome Browser
Species Human (GRCh38)
Location 9:112375898-112375920
Sequence AGTTATCTGCAGAAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059196505_1059196508 15 Left 1059196505 9:112375860-112375882 CCAGTAACAGGCTAAGAGCTGTC No data
Right 1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG No data
1059196502_1059196508 25 Left 1059196502 9:112375850-112375872 CCACCAAAGCCCAGTAACAGGCT No data
Right 1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG No data
1059196504_1059196508 16 Left 1059196504 9:112375859-112375881 CCCAGTAACAGGCTAAGAGCTGT No data
Right 1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG No data
1059196503_1059196508 22 Left 1059196503 9:112375853-112375875 CCAAAGCCCAGTAACAGGCTAAG 0: 9
1: 177
2: 167
3: 118
4: 218
Right 1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059196508 Original CRISPR AGTTATCTGCAGAAGAAGGC AGG Intergenic
No off target data available for this crispr