ID: 1059196801

View in Genome Browser
Species Human (GRCh38)
Location 9:112378319-112378341
Sequence TAGTGTAAGTACAGGTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059196799_1059196801 -4 Left 1059196799 9:112378300-112378322 CCATCGCAAAGTATAAAAATAGT No data
Right 1059196801 9:112378319-112378341 TAGTGTAAGTACAGGTATTTAGG No data
1059196798_1059196801 9 Left 1059196798 9:112378287-112378309 CCTTCTGTGAAAGCCATCGCAAA No data
Right 1059196801 9:112378319-112378341 TAGTGTAAGTACAGGTATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059196801 Original CRISPR TAGTGTAAGTACAGGTATTT AGG Intergenic
No off target data available for this crispr