ID: 1059197092

View in Genome Browser
Species Human (GRCh38)
Location 9:112380270-112380292
Sequence ATCCTTGACCTCCCACAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059197092_1059197097 4 Left 1059197092 9:112380270-112380292 CCCGGCTGTGGGAGGTCAAGGAT 0: 1
1: 0
2: 0
3: 26
4: 317
Right 1059197097 9:112380297-112380319 CCTGGGCACGCTCTGAGCTCTGG 0: 1
1: 1
2: 3
3: 22
4: 239
1059197092_1059197099 15 Left 1059197092 9:112380270-112380292 CCCGGCTGTGGGAGGTCAAGGAT 0: 1
1: 0
2: 0
3: 26
4: 317
Right 1059197099 9:112380308-112380330 TCTGAGCTCTGGTCCGCGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 93
1059197092_1059197098 14 Left 1059197092 9:112380270-112380292 CCCGGCTGTGGGAGGTCAAGGAT 0: 1
1: 0
2: 0
3: 26
4: 317
Right 1059197098 9:112380307-112380329 CTCTGAGCTCTGGTCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059197092 Original CRISPR ATCCTTGACCTCCCACAGCC GGG (reversed) Intronic
900006499 1:58058-58080 AGTCTTTACCTCCCACAGTCTGG + Intergenic
900651076 1:3730327-3730349 CCCCTCCACCTCCCACAGCCAGG - Intronic
901126264 1:6930877-6930899 TTCCTTCTCCTCCCTCAGCCTGG + Intronic
901530463 1:9849482-9849504 ACCCCTGACCTACCCCAGCCAGG - Exonic
901774945 1:11554079-11554101 ATCCTTCAGCTCCAACAGTCCGG + Intergenic
902253587 1:15172300-15172322 AGCCTTGACCTCCCAGGGTCAGG - Intronic
902333338 1:15741577-15741599 AGCCTTCTCCTCCCACAGGCCGG - Intergenic
902688585 1:18095375-18095397 CTTCTTGATCTTCCACAGCCTGG + Intergenic
902775853 1:18674512-18674534 ATTCTTGACAGACCACAGCCTGG - Intronic
903081992 1:20817922-20817944 CTCCTTGGCCTCCCAAAGACGGG + Intronic
903396944 1:23008754-23008776 ATCCTTGACCTCCCAGGCTCAGG + Intergenic
903866110 1:26399273-26399295 ATCCTCGACCTCCCAGACTCAGG + Intergenic
904938305 1:34147439-34147461 CTCCTAGACCTTCCACAGTCTGG - Intronic
905063446 1:35159443-35159465 TGCCTTGGCCTCCCACAGGCTGG + Intergenic
905093379 1:35447955-35447977 ATAGTTGACCTCCTACACCCTGG + Intronic
905198309 1:36298753-36298775 CTCCTTGGCCTCCCAAAGCATGG + Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905765200 1:40594862-40594884 CTCCTTGGCCTTCCAAAGCCTGG - Intergenic
906376816 1:45303248-45303270 AGCCTTAACCTCCCCCAGCTCGG + Intronic
906940320 1:50249989-50250011 GTCCTTGTCCTTCCACAGCTCGG - Intergenic
907313783 1:53554735-53554757 ATCATTGGGCCCCCACAGCCGGG + Intronic
907664595 1:56423840-56423862 GTCCTTGACCAGACACAGCCTGG + Intergenic
907962377 1:59295976-59295998 AACCTCGAACTCCCTCAGCCTGG + Intergenic
908156731 1:61360981-61361003 ATCCTTGAGTTCCCAGAACCTGG - Intronic
909011947 1:70344382-70344404 AGCCTTGACCTCCGACACTCAGG - Intronic
909945981 1:81663343-81663365 ATCCCTCACCTCCCACCTCCCGG + Intronic
911034511 1:93526576-93526598 CTCCTAGACTCCCCACAGCCAGG - Intronic
911054958 1:93701405-93701427 ATCAATGCCCTCCCCCAGCCTGG - Intronic
912399811 1:109380726-109380748 CGCCTTGGCCTCCCAAAGCCTGG - Intronic
912447930 1:109751688-109751710 ATCCTGGAGCCCCTACAGCCGGG - Exonic
913174817 1:116263710-116263732 ACACTCGACCTCCCAAAGCCTGG - Intergenic
913334730 1:117698673-117698695 CTCCCTTACCTCCCACACCCAGG - Intergenic
915249864 1:154580212-154580234 AGCCTTGACTTCCCAGAGCACGG - Intergenic
916926811 1:169530232-169530254 TTCCTTGACCTCTCTTAGCCTGG - Intronic
917475674 1:175367024-175367046 ATCCTTGATCTCTGACAGGCAGG - Intronic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
921532815 1:216306737-216306759 ATCCTGGAGCACCCACATCCAGG - Intronic
921866037 1:220088706-220088728 AACCTTGACCTCCCAGGGTCTGG - Intronic
923141989 1:231168215-231168237 TACCTTGGCCTCCCAAAGCCTGG + Intronic
923337674 1:232984554-232984576 AGCCTTTAGCTCCCACAGCACGG - Intronic
923665072 1:235992345-235992367 AGCCTTCACCTCCCCCCGCCAGG + Intronic
924136541 1:240972965-240972987 ACCCTTGACCTCCCAGGCCCAGG - Intronic
924673673 1:246153718-246153740 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
1064061030 10:12137383-12137405 AGCCTTGACTTCCCCAAGCCCGG + Intronic
1065193718 10:23240107-23240129 AGCCTTGACCTCCCAGACTCAGG - Intergenic
1065322985 10:24525907-24525929 AGCCTTGACCTCCCTGGGCCTGG - Intronic
1068235994 10:54233023-54233045 AGCCTTGACTTCCCAGACCCAGG + Intronic
1068624718 10:59230293-59230315 ATCCTTGACCTCCTAGACTCAGG + Intronic
1069829186 10:71272166-71272188 AGACTTGACCTCCCACTGCATGG - Intronic
1070120385 10:73570658-73570680 CACCTTGACCTCCCAAAGGCTGG + Intronic
1070581005 10:77719528-77719550 ATCTTTGCTCTGCCACAGCCTGG - Intergenic
1071450797 10:85790186-85790208 AGCCTTGTCCTCCCACATCTGGG - Intronic
1072335407 10:94393888-94393910 AGCCTTGACCTCCCAGACTCAGG - Intergenic
1072633254 10:97161413-97161435 CTCGTTGCCCTCCTACAGCCTGG - Intronic
1075613497 10:123873728-123873750 ATACTTGACATCCAACAGACAGG + Intronic
1076427528 10:130378387-130378409 CTCCTGGTCCTCCCACTGCCTGG + Intergenic
1078521062 11:12063668-12063690 AGCCTTGACCTCCCAGACTCAGG + Intergenic
1078621828 11:12915332-12915354 ATCCTTCTGCCCCCACAGCCAGG + Intronic
1080821014 11:35806580-35806602 TTCCTTGACCTACCACAACCAGG - Exonic
1081541477 11:44037617-44037639 AAACTTCACCTTCCACAGCCTGG - Intergenic
1082731304 11:56801205-56801227 GTCCTTGACTTCCCACAGCATGG - Intergenic
1084617764 11:70247778-70247800 CTCCTTCCCCTCCCAGAGCCAGG + Intergenic
1085030771 11:73269741-73269763 ATTCATGTCCTCCCCCAGCCTGG + Intronic
1085054351 11:73395178-73395200 CTCCCTGACTCCCCACAGCCTGG + Exonic
1089086678 11:115825472-115825494 AGCCTTGACCTCCCAGACTCAGG + Intergenic
1090361966 11:126179229-126179251 AGCCTTGACCTCCCAGACTCAGG - Intergenic
1090665834 11:128914413-128914435 CTCCTTCCCCTCCCACAACCCGG + Intronic
1093989533 12:25574343-25574365 ACCCTTGCCCTCCCCCATCCAGG + Intronic
1094499525 12:31009607-31009629 ATACATGACCTCCTTCAGCCCGG + Intergenic
1095339536 12:41073034-41073056 AGCTTTGATCTCCCAAAGCCTGG - Intergenic
1096087767 12:48877555-48877577 ATCCTTGGCCTTCAGCAGCCTGG - Intergenic
1096364526 12:51016929-51016951 AGCCTTGACCTCCCAGACTCAGG - Intronic
1097114518 12:56687861-56687883 ATCCTGGACCTCCCGCCCCCAGG + Intronic
1098525008 12:71477182-71477204 ATCCCTTAGCTCACACAGCCAGG + Intronic
1100922404 12:99503016-99503038 AGCCTTGACCTCCCAAACTCAGG + Intronic
1102191788 12:110994304-110994326 CTCCATGTCCTCACACAGCCTGG - Intergenic
1103453423 12:121045981-121046003 AGCCTTGACTTCCCACATTCAGG - Intergenic
1104187062 12:126442997-126443019 TTCCTGGACCTCCCACAGAAAGG + Intergenic
1106950977 13:34883575-34883597 ATCCCTGGCCTCCCACAGCTGGG - Intergenic
1107618655 13:42200889-42200911 ATCCTTGACACCCCATACCCAGG + Intronic
1107910160 13:45098329-45098351 TGCCTTGCCCTCCCAAAGCCTGG - Intergenic
1109645150 13:65244531-65244553 AGCCTCGACCTCCCAGAGTCAGG + Intergenic
1109969856 13:69753916-69753938 ATCCTTGACCTCCCAGGCTCAGG + Intronic
1112750301 13:102576506-102576528 AGCCTTGACCTCCCACGCTCAGG + Intergenic
1116997497 14:51339307-51339329 ATCCTTGACCTCAAACCTCCAGG + Intergenic
1117054464 14:51897692-51897714 TTCCTTGCCCTCCCAGAACCAGG - Intronic
1117419754 14:55532781-55532803 AGCCTTGACCTCCCAGACTCAGG - Intergenic
1118274629 14:64374808-64374830 AGCCTTGACCTCCCAGGCCCAGG + Intergenic
1118302945 14:64631397-64631419 AACCTTGACCTCCCACGTTCAGG - Intergenic
1118898093 14:69963699-69963721 CACCTTGACCTCCCACAGGAAGG - Intronic
1119003300 14:70902792-70902814 ATCCTTGACCTCCCAGGCTCAGG + Intergenic
1119119812 14:72064220-72064242 CTCCTTCACCTCCTTCAGCCTGG - Intronic
1120197182 14:81496912-81496934 ATCCTTGACTTACCAAAGTCTGG - Intronic
1120946887 14:90006458-90006480 ATCCTTGACCTCCCAGGCTCAGG + Intronic
1121659614 14:95625006-95625028 ACCCATGACCTCCAATAGCCTGG - Intergenic
1122291004 14:100680488-100680510 ATCCTCGGCTTCCCACAGCCAGG - Intergenic
1123587564 15:21773027-21773049 ATCCCTGAGGTCCCACAGCCTGG - Intergenic
1123624202 15:22215592-22215614 ATCCCTGAGGTCCCACAGCCTGG - Intergenic
1123807989 15:23895070-23895092 ATCCTTGCCAAACCACAGCCAGG + Intergenic
1124155147 15:27218995-27219017 ATGCTTGCCCTCCCAGACCCCGG - Intronic
1126140764 15:45436358-45436380 AGCCTTGACCTCCCAGGGTCAGG - Intronic
1128184122 15:65630044-65630066 AGCCTTGACCTCCCAGACTCAGG + Intronic
1129074347 15:72978871-72978893 ATCCTTGACCTCCCATGCTCGGG - Intergenic
1129790589 15:78338335-78338357 ATCCCTTGCCTCCCACATCCAGG + Intergenic
1129794735 15:78367477-78367499 AGCCTTGACCTCCCAGGCCCAGG - Intergenic
1131002549 15:88950262-88950284 AGCTTTGACCTCCCAGACCCAGG - Intergenic
1131199198 15:90382370-90382392 ATCTCTGACCACCCACAGGCAGG - Intergenic
1132447023 15:101932899-101932921 AGTCTTTACCTCCCACAGTCTGG - Intergenic
1134099115 16:11439253-11439275 ATCCTTCACCCCCTTCAGCCTGG + Intronic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1136178637 16:28535957-28535979 CTCCTTGGCCTCCCAAAGGCTGG + Intronic
1136519657 16:30787265-30787287 ACCCTTTGCCTCCCGCAGCCTGG + Intergenic
1136760002 16:32724919-32724941 AACCTTAACCTCCCAGACCCAGG - Intergenic
1136808102 16:33145467-33145489 AACCTTAACCTCCCAGACCCAGG + Intergenic
1136927606 16:34388999-34389021 ATCCTTGGCCGCCCCCAGCGCGG - Intergenic
1136976968 16:35022807-35022829 ATCCTTGGCCGCCCCCAGCGCGG + Exonic
1137283418 16:46997105-46997127 ATCCTTGACTTCCCAGACTCAGG - Intergenic
1137557978 16:49484631-49484653 ATCCTTGACCTGCCTGAGCCGGG - Intergenic
1137668446 16:50265685-50265707 CTCCTCCACCTCCCACATCCAGG - Intronic
1138791269 16:59906806-59906828 TTCCTTGACCTCCCAAAAGCTGG + Intergenic
1139469500 16:67170618-67170640 TTCCCTTCCCTCCCACAGCCGGG - Intronic
1141190243 16:81819411-81819433 ATCCTTGACTTCTCCAAGCCTGG - Intronic
1141543236 16:84743309-84743331 ACCCTTCACCCCCCACAGTCGGG + Intronic
1141684946 16:85564857-85564879 GTCCTTGTCCTCAGACAGCCAGG + Intergenic
1141839587 16:86566272-86566294 ATCCTTGACGACCCCGAGCCTGG + Intergenic
1141889180 16:86915209-86915231 TTCCTTGACTTGGCACAGCCGGG - Intergenic
1142634568 17:1248846-1248868 CGCCTTGGCCTCCCAAAGCCGGG - Intergenic
1144600379 17:16607630-16607652 GTCCTGGGACTCCCACAGCCTGG + Intergenic
1144632500 17:16881342-16881364 AGCCTTGTTCTCCCCCAGCCTGG - Intergenic
1144638219 17:16924231-16924253 AGCCTTGTCCTCCCCCAGCCTGG - Intergenic
1145242331 17:21247337-21247359 ATGCTGGCCTTCCCACAGCCAGG + Intronic
1146406645 17:32544175-32544197 AGCCTTGACCTCCCGCACTCAGG + Intronic
1149562065 17:57615207-57615229 AGCCTTGACCTCCCAGACTCAGG + Intronic
1150722448 17:67625237-67625259 CTCCGTGACCTCCCACACCCAGG + Intronic
1151167417 17:72217334-72217356 ATCCTTCTACTCCCAGAGCCCGG - Intergenic
1151499388 17:74479316-74479338 AGCCTCGACCCCCCACTGCCCGG + Intronic
1151836388 17:76585484-76585506 AGCCTTGACCTCGCGCTGCCCGG - Intronic
1151988830 17:77561051-77561073 ATCCAAGACCTCCTCCAGCCTGG - Intergenic
1152483404 17:80572177-80572199 AGCCTTGACCTCCCACGGTCAGG + Intronic
1152860770 17:82696116-82696138 CGCCTTGGCCTCCCAAAGCCGGG + Intronic
1153794671 18:8610514-8610536 ATCCATGACCTCAAACAACCCGG + Intronic
1156859528 18:41819576-41819598 ATCCCTGACCCCAAACAGCCTGG + Intergenic
1157870117 18:51222458-51222480 ATCCTTGCCCTCACAGAGCTTGG - Intergenic
1158525768 18:58212206-58212228 AGCCTTGACCTCCCAGACTCAGG + Intronic
1158722962 18:59942284-59942306 AGCCTTGACCTCCCAGACTCAGG + Intergenic
1158774754 18:60563958-60563980 TTCCATGACCTCCAAAAGCCAGG + Intergenic
1160638253 19:99634-99656 AGTCTTTACCTCCCACAGTCTGG + Intergenic
1161092983 19:2372103-2372125 TGCCTTGACCTCCCAAAGTCTGG + Intergenic
1161782191 19:6300393-6300415 AACCTTGACCTCCCAAAGTGTGG + Intergenic
1163086634 19:14985712-14985734 CTCCTTGGCCTCCCAAAGGCTGG - Intronic
1163419206 19:17204750-17204772 AGCCTTGACCTCCCAGGCCCAGG - Intronic
1163728989 19:18939086-18939108 CTGCTTGGCCTCCCTCAGCCTGG - Exonic
1165131261 19:33633878-33633900 AGCCTTGACCTCCCACGTTCAGG + Intronic
1165680684 19:37772213-37772235 ATCCTTGACCTCCCAGGCCCAGG + Intronic
1166230894 19:41425438-41425460 CTCCTTGGCCTCCCCCAGCCAGG - Exonic
1166336099 19:42108491-42108513 AGCCTTGACCTCCCAGGGTCAGG - Intronic
1166805309 19:45483400-45483422 TTCCTTGGCCTCCCAAAGGCTGG + Intergenic
1166887867 19:45972887-45972909 CTCCTTCCCCTCCCCCAGCCAGG + Intronic
1168086690 19:54052898-54052920 AGCCTTGACCTCCCAGGCCCAGG - Intronic
925194157 2:1910056-1910078 ACCCTTGCCCTCACACAGCCTGG + Intronic
925504794 2:4549913-4549935 ATCCTTGCACTCCCAAAGGCTGG + Intergenic
925554355 2:5113627-5113649 ATCTGTGACCTCCCTCAGCTTGG - Intergenic
925670800 2:6308022-6308044 TTCCTTGTCCTCCCAAAGCATGG - Intergenic
925801442 2:7605771-7605793 ATACTTGACCTGTCAAAGCCAGG - Intergenic
926096840 2:10086827-10086849 TTCCTTGGCCTCCCAAAGTCAGG + Intergenic
926194166 2:10751975-10751997 AGCCTTGACCTCCCAGACTCAGG - Intronic
926961550 2:18363560-18363582 GTCAGTCACCTCCCACAGCCAGG + Intergenic
928296441 2:30088160-30088182 ATCCACGTCCTCTCACAGCCTGG - Intergenic
928559324 2:32462705-32462727 AGCCTTGGCCTCCCAAAGGCTGG - Intronic
932891412 2:75600196-75600218 ATCCTAGGCCACCCAGAGCCTGG + Intergenic
937251077 2:120524216-120524238 ATCCTCCACCTCCCACAGCATGG - Intergenic
938307676 2:130266146-130266168 CTCCCTGGCCTCCCACTGCCTGG - Intergenic
938447659 2:131390696-131390718 CTCCCTGGCCTCCCACTGCCTGG + Intergenic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
940467531 2:154050960-154050982 ATACTTGACCTCCCCCTCCCAGG + Intronic
940630367 2:156230330-156230352 ATCCATGACCTGCAACATCCTGG + Intergenic
942023843 2:171894006-171894028 CTCCTTCCCCTCCCCCAGCCGGG + Intronic
942098868 2:172558536-172558558 ATCCCTCGCCTCCCACAGGCAGG + Intronic
942298966 2:174543950-174543972 AGCCTTGACCTCCCAGACTCAGG - Intergenic
944478693 2:200132696-200132718 AGCCTTGCACTCCCACAGCAGGG - Intergenic
945674118 2:212834219-212834241 ATGCCTGGCCTCCCACAGCAGGG + Intergenic
946204327 2:218092586-218092608 ACCATAGACCTCCCAGAGCCTGG + Intergenic
947705532 2:232272535-232272557 ATCCCTTACCTCTCACAGCGTGG - Intronic
948062656 2:235052947-235052969 AGCCTTGACATCCTAAAGCCAGG - Intronic
948796389 2:240404438-240404460 AGCCTTGACCTCCCAAGCCCAGG - Intergenic
948799608 2:240426069-240426091 ATACTTAACCTCCCTGAGCCAGG + Intergenic
1169078042 20:2774179-2774201 TTCCTTGACCTCCCAAAGTTTGG + Intergenic
1170512826 20:17096618-17096640 CTCCTTGAAATCCCACAGCTTGG + Intergenic
1172400663 20:34648628-34648650 AGCCTTGACCTCCCAGACTCAGG + Intronic
1172536249 20:35675626-35675648 CGCCTTGACCTCCCACAGTTGGG - Intronic
1172748776 20:37234760-37234782 AGCCTTGACCTCCCAGACTCAGG + Intronic
1174600506 20:51720583-51720605 CACCTTGACCTCCCAAAGCTGGG - Intronic
1174895816 20:54448941-54448963 AGCCTTGACCTCCCAGACTCCGG - Intergenic
1175171646 20:57085244-57085266 ATCCTTGGCCTTGCAAAGCCTGG + Intergenic
1175803744 20:61815701-61815723 GGCCTGGACCTCCCTCAGCCGGG - Intronic
1176962456 21:15174905-15174927 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1177588423 21:23129175-23129197 CGCCTTGACCTCCCAAAGCGTGG + Intergenic
1178244116 21:30935636-30935658 AGCCTGGCACTCCCACAGCCAGG + Intergenic
1178938270 21:36882917-36882939 CTCCTTGCCCTTCCACAACCAGG + Intronic
1180802384 22:18637933-18637955 ATCCCTGACCACACACAGCTGGG - Intergenic
1180853620 22:19033488-19033510 ATCCCTGACCACACACAGCTGGG - Intergenic
1181219340 22:21357328-21357350 ATCCCTGACCACACACAGCTGGG + Intergenic
1182371605 22:29815044-29815066 ATCCTTGGCCTCCCAAAGTTTGG - Intronic
1182473466 22:30562622-30562644 ATCCCTGAGCTCCCCGAGCCTGG + Intronic
1182608380 22:31525633-31525655 ATCCTTGACCTCCCAGATTCAGG - Intronic
1183135891 22:35887365-35887387 TTCCTTGCCCTCCCACGCCCTGG + Intronic
1183714526 22:39525945-39525967 TGCCTTGGCCTCCCAAAGCCAGG - Intergenic
1184432595 22:44450136-44450158 ATCCTTTACATCCCAAACCCAGG + Intergenic
1185095340 22:48803323-48803345 CTTCTTGACCACGCACAGCCAGG - Intronic
1185285351 22:49997479-49997501 ACCCTTCACTCCCCACAGCCTGG - Intronic
949876704 3:8630871-8630893 AACCTTGATGTCCCAGAGCCTGG + Exonic
950418872 3:12885001-12885023 AGCCTTGTCCTCACACAGCGAGG + Intergenic
950677272 3:14561859-14561881 ATCCTCTCCCTCCCCCAGCCTGG - Intergenic
952855925 3:37770837-37770859 CTCCTTGGGCTCCCACAGCCAGG + Intronic
953432550 3:42851729-42851751 ATGCCTGAGCTCCCCCAGCCAGG - Intronic
954004398 3:47579489-47579511 AGCCTAGATCTCGCACAGCCAGG + Exonic
954921615 3:54195765-54195787 ATGCTTGACATCCCTCAGCCTGG - Intronic
954959340 3:54550471-54550493 ATCCTTGACCGCCCACATTTGGG - Intronic
955522980 3:59793021-59793043 CTCCCTGACCTCCCAGAGCCTGG - Intronic
956889417 3:73597234-73597256 ATGCTTTCCCTCCCAGAGCCAGG - Intronic
957939904 3:86991187-86991209 CTCCCTGTCCTCGCACAGCCGGG - Intergenic
958500075 3:94894192-94894214 CTCCTTGGCCTCCCAAAGGCTGG + Intergenic
959059227 3:101601037-101601059 ACCCTTGGCCTCCCACAGTAAGG + Intergenic
963088671 3:141462086-141462108 ATCCTTCTCCTCCCAAAGCTAGG - Intergenic
963604918 3:147405731-147405753 CTCCTTGCCCTCCCTCACCCTGG - Intronic
963836632 3:150064082-150064104 ATCCTTGAACTCACAAACCCAGG - Intergenic
964335806 3:155653265-155653287 AGCCTTGACCTCCCATGGGCTGG + Intronic
966631277 3:182077890-182077912 ATCCTTGACCTCCCAGACTCAGG - Intergenic
966939101 3:184734204-184734226 ATCCCAGACCTCTCACAGCAGGG - Intergenic
967356724 3:188579917-188579939 AGCCTTGACCTCCTACCTCCTGG - Intronic
968966147 4:3769984-3770006 ATCCCTGACCTCCCCCGACCAGG + Intergenic
968968352 4:3780880-3780902 AGCCTCGGCCTCCCACATCCTGG - Intergenic
969352899 4:6608376-6608398 CTCATTGTCCGCCCACAGCCAGG + Intronic
969432113 4:7161395-7161417 ATCCTTGACCTCCCAGGCTCAGG - Intergenic
969457343 4:7307538-7307560 AGCCCTGACCTGCCCCAGCCTGG - Intronic
969473263 4:7402542-7402564 ATCCTAGCTCTCCCACAGCAGGG - Intronic
969608803 4:8215905-8215927 GGGCTTGACCTCTCACAGCCCGG + Intronic
970416368 4:15861769-15861791 TTCCTTGGACTCCCACTGCCTGG - Intergenic
972542500 4:40051784-40051806 AGCCTTCACCTCCCAGACCCAGG + Intergenic
976570262 4:86599007-86599029 CTCCTTGGCCTCCCAAAGCACGG + Intronic
976644119 4:87369681-87369703 TGCCTTGGCCTCCCAAAGCCTGG + Intronic
976731162 4:88263518-88263540 AGCCTTGACCTCCCAGACCCAGG + Intronic
976986342 4:91303711-91303733 AACCTTGACCTCCCAGACTCAGG - Intronic
977666995 4:99653682-99653704 CTCCTTCTCCTCCCACGGCCTGG + Exonic
978080066 4:104581272-104581294 CTCCTTGGCCTCCCAAAGTCTGG - Intergenic
979673582 4:123386438-123386460 ATCCTTGTTCTCCCACATGCCGG + Intergenic
981070384 4:140529493-140529515 AACCTTGACATCTCTCAGCCTGG + Intronic
981995471 4:150969547-150969569 AGCCTTGACCTCCCAGACTCAGG + Intronic
982005421 4:151058532-151058554 AGCCTCGACCTCCCACACTCAGG - Intergenic
985476081 5:80051-80073 ACCCATGACCCACCACAGCCTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985883811 5:2660483-2660505 AGCCTTCCCCTCACACAGCCTGG + Intergenic
987242741 5:16017384-16017406 AGCCTGGATCTCCAACAGCCTGG - Intergenic
987727800 5:21725457-21725479 ATCCTTGACCTCCCAGGCTCAGG + Intergenic
991362331 5:65833438-65833460 AGCCTTGACCTCCCAAGCCCAGG - Intronic
994926286 5:106121001-106121023 CTCCTTGACCACCCACTGTCTGG - Intergenic
997091273 5:130861581-130861603 ATGCCTGACCTTCCACAGGCTGG - Intergenic
998109396 5:139489444-139489466 AGCCTTGACCTCCCAGACTCAGG + Intergenic
1000922232 5:167151868-167151890 TTTATTGACCTCCCACAGCATGG - Intergenic
1001321326 5:170684663-170684685 AGCCTTGACCTCCCACCAGCGGG + Intronic
1001582863 5:172811284-172811306 CGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1002563612 5:180098331-180098353 ATCCTTCACATCCCTCAGGCAGG - Intergenic
1005287965 6:24349317-24349339 ATGCATGACCTCTCACATCCAGG - Intronic
1007805827 6:44445179-44445201 ATCCCTCAGCTCCCAGAGCCAGG + Intronic
1008047992 6:46871440-46871462 ATTCTTGAATTCCAACAGCCTGG - Intronic
1008679445 6:53856816-53856838 ATGCCTGGCCTCCCACATCCAGG - Intronic
1010451773 6:76012228-76012250 ATCCTTAAGCTACTACAGCCTGG + Intronic
1011156556 6:84340338-84340360 ATCCTTGAGCACCCACAACCAGG - Intergenic
1011194571 6:84767829-84767851 ATCCTTGAGCTCCCAGATCTGGG + Intergenic
1012990968 6:105925290-105925312 ATCCTTGACTTCCCAGGCCCAGG - Intergenic
1015822429 6:137278996-137279018 ATCCTGGGCATCCCGCAGCCTGG + Intergenic
1017760605 6:157565163-157565185 AACCTTGACCTCCCAGACGCAGG - Intronic
1017813326 6:157999714-157999736 TTCCTTGCCCTCCCAAACCCTGG - Intronic
1019311961 7:367229-367251 TTCCTGGACCTCACCCAGCCAGG + Intergenic
1020101507 7:5396813-5396835 ATCTGTGAGCTCCCACAGGCTGG - Intronic
1021649141 7:22815976-22815998 ATGCTTGTGCTCCCTCAGCCTGG - Intronic
1022169685 7:27813434-27813456 AGCCTTGACCTCCCAGACTCAGG + Intronic
1022474561 7:30701464-30701486 ATCCTTATCCTCCCAGAGCTTGG - Intronic
1024061180 7:45699861-45699883 ATCCTTGTCCTCCAAGATCCAGG + Intronic
1024128112 7:46321631-46321653 ATCCTCCACCTCCCACACTCTGG - Intergenic
1027392328 7:77717189-77717211 CTCCTTGACCTCCCAAAGTTGGG + Intronic
1027413410 7:77947037-77947059 AGCCTTGACCTCCCAAGGCTCGG - Intronic
1028112786 7:86962605-86962627 ATCCTAGACCTGCCGCATCCGGG + Intronic
1028151527 7:87379059-87379081 CTCCTTGACCTTCCTCAGTCTGG + Intronic
1028434234 7:90782893-90782915 ATCCTTGTACTCTCACTGCCTGG - Intronic
1028529564 7:91824133-91824155 ATCCCTGAGCACCCACATCCAGG - Intronic
1028682067 7:93546961-93546983 ATCTTTATCCTCCCACAGTCGGG + Intronic
1030458874 7:109806418-109806440 AGCCTTGACCTCCCAGAGTCAGG - Intergenic
1030835658 7:114281348-114281370 CTCCTTGGCCTCCCAAAGTCTGG + Intronic
1031015848 7:116575607-116575629 AGCCTCGACCTCCCAGACCCGGG - Intergenic
1032599640 7:133279598-133279620 AGCCTCGACCTCCCACACTCAGG + Intronic
1033405427 7:141068416-141068438 CTCCTTGGCCTCCCAAAGCTGGG + Intergenic
1033986648 7:147234701-147234723 ATCCTTAATTTCCCTCAGCCTGG + Intronic
1034051715 7:147990795-147990817 ATCATTGAACACCCAAAGCCTGG - Intronic
1034218440 7:149425538-149425560 AGCCTGGACCTCCCACATTCAGG - Intergenic
1034826986 7:154274761-154274783 ACTCATGACCTCCCAGAGCCAGG - Intronic
1034885438 7:154794925-154794947 AGCCTTGGCCCCCCTCAGCCAGG - Intronic
1035566561 8:644983-645005 ATCCTTCTCCTCCCACGGGCTGG + Intronic
1036547865 8:9789557-9789579 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1037235410 8:16714268-16714290 AGCCTTGACCTCCCAAAGTGCGG - Intergenic
1037435062 8:18853743-18853765 ATTAGTGACCTTCCACAGCCTGG + Intronic
1039489419 8:37936394-37936416 AACCTTGACCTCCCAAAGGAGGG + Intronic
1039835171 8:41250120-41250142 CTGCCTGGCCTCCCACAGCCGGG + Intergenic
1039879593 8:41616375-41616397 AACCTTGACCTCCCACATTTAGG + Intronic
1042310926 8:67378933-67378955 TGTCTTGGCCTCCCACAGCCAGG + Intergenic
1042526287 8:69768149-69768171 AGCCTTGACCTCCCAAACTCAGG - Intronic
1043628528 8:82295627-82295649 ATCCTTCAACTCTCACAGCAGGG + Intergenic
1044138703 8:88620465-88620487 AGCCTTGACCTCCCAGAATCAGG - Intergenic
1044865397 8:96565793-96565815 ATCCTTCACCTCCCATCCCCAGG - Intronic
1044998515 8:97859724-97859746 CTCCTTGTCTTCCCAGAGCCAGG - Intergenic
1046314710 8:112483979-112484001 CACCTTGACCTTCAACAGCCAGG - Intronic
1046542074 8:115598549-115598571 AGCCTTGGCCTCCCACATGCTGG + Intronic
1046731644 8:117732504-117732526 ATACTGGACCTCCCCCAGTCAGG - Intergenic
1046875859 8:119253929-119253951 AACCTTAACCACCCACATCCAGG - Intergenic
1047985613 8:130229981-130230003 ATCCTTGACCTCCCAGGCTCAGG - Intronic
1048267499 8:133000332-133000354 CCCCTTGCCCTCCCACAGGCTGG + Intronic
1055528031 9:77155029-77155051 TGCCTTGGCCTCCCAAAGCCTGG - Intergenic
1055801771 9:80045336-80045358 AGCCTTGACCTCCCAAGGCTCGG + Intergenic
1055906917 9:81305692-81305714 ATCCTCCACATCCCACAGCTTGG - Intergenic
1056222332 9:84462705-84462727 AGCCTTGGCCTCCCAAAGCATGG - Intergenic
1056803662 9:89711652-89711674 ATCCCTGGCCTGCCACAGCCTGG - Intergenic
1057008150 9:91578771-91578793 ATCCTGGAACTCCCACAGGGTGG + Intronic
1057283306 9:93727792-93727814 ATCCTTGAGCTCCCAGACCTTGG - Intergenic
1057299786 9:93871194-93871216 ACACCTGACCTCCCACAGTCTGG + Intergenic
1059197092 9:112380270-112380292 ATCCTTGACCTCCCACAGCCGGG - Intronic
1059481983 9:114598632-114598654 ATCCTTGTCCTGGGACAGCCTGG + Intergenic
1060003512 9:119979787-119979809 TTCCTTGACATCACACAGCAGGG - Intergenic
1061277122 9:129575639-129575661 ATCCTTTGCCTCTCAGAGCCTGG - Intergenic
1061413621 9:130433846-130433868 AGCCTTGACCCCCGACAGCGAGG + Exonic
1061681605 9:132245205-132245227 CTCCTTGACCTCCGTCAGCTGGG + Intergenic
1062139456 9:134947826-134947848 ATCCTTGCCCCCACACTGCCTGG + Intergenic
1062365859 9:136208746-136208768 GTGCTTGACCTTCCACCGCCTGG + Exonic
1062463263 9:136670714-136670736 AGCCTTGACCTCCCTCAGCGTGG + Intronic
1187000681 X:15173780-15173802 ATCCTTGACCTACCACGGTGTGG - Intergenic
1187338581 X:18401946-18401968 ATCCTTGACCTCCCATCTCTGGG + Intergenic
1187370743 X:18704003-18704025 ATCCTTGACCTCCCAGGCTCAGG + Intronic
1192387223 X:70683538-70683560 AGCCTTGACCTCCCAGGGTCAGG - Intronic
1194095250 X:89631773-89631795 ATCCCTGAGCACCCACATCCGGG - Intergenic
1195891178 X:109696960-109696982 AGCCTTGACCTCCCAGACTCTGG - Intronic
1197821287 X:130543394-130543416 ATCCTTGGTCACCCACATCCAGG - Intergenic
1198760665 X:140029200-140029222 AGCCTTGACCTCCCAGACTCAGG + Intergenic
1199922604 X:152425012-152425034 AGCCTTGACCTCCCAGGCCCAGG + Intronic
1200940524 Y:8775666-8775688 ATCCCTTACTCCCCACAGCCAGG + Intergenic
1201312474 Y:12609417-12609439 AACCTTGGCCTCCCAAAGCCTGG - Intergenic