ID: 1059197841

View in Genome Browser
Species Human (GRCh38)
Location 9:112387550-112387572
Sequence ATTTAGTAGTTGAATAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059197839_1059197841 14 Left 1059197839 9:112387513-112387535 CCTACCTAGGATTTGTTTTCTGA 0: 1
1: 0
2: 3
3: 18
4: 236
Right 1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG No data
1059197838_1059197841 19 Left 1059197838 9:112387508-112387530 CCATGCCTACCTAGGATTTGTTT 0: 1
1: 0
2: 3
3: 56
4: 618
Right 1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG No data
1059197840_1059197841 10 Left 1059197840 9:112387517-112387539 CCTAGGATTTGTTTTCTGATGAT 0: 1
1: 0
2: 4
3: 23
4: 327
Right 1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG No data
1059197837_1059197841 22 Left 1059197837 9:112387505-112387527 CCACCATGCCTACCTAGGATTTG 0: 1
1: 0
2: 8
3: 201
4: 5178
Right 1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059197841 Original CRISPR ATTTAGTAGTTGAATAAACA TGG Intronic
No off target data available for this crispr