ID: 1059201288

View in Genome Browser
Species Human (GRCh38)
Location 9:112419506-112419528
Sequence AAAAGATTCTTAAAGTGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 325}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059201288_1059201290 -10 Left 1059201288 9:112419506-112419528 CCGGAACACTTTAAGAATCTTTT 0: 1
1: 0
2: 2
3: 21
4: 325
Right 1059201290 9:112419519-112419541 AGAATCTTTTGAAGGCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059201288 Original CRISPR AAAAGATTCTTAAAGTGTTC CGG (reversed) Intronic
903457867 1:23500714-23500736 AAAATATTCTAAAAGTGATATGG - Intergenic
905127658 1:35726864-35726886 AAAACTTTCTTAAACTGTCCAGG - Intronic
905131945 1:35768072-35768094 AAAAAATTATTAAATTGGTCAGG + Intronic
906875984 1:49539845-49539867 AAAGGATTTTTTAAATGTTCAGG + Intronic
907925281 1:58950107-58950129 CAAAAATTCCAAAAGTGTTCAGG - Intergenic
909862431 1:80625169-80625191 AAAAGAAAATTAAATTGTTCAGG - Intergenic
910324303 1:85987268-85987290 AAAAGATTTTTTTAGTGGTCAGG + Intronic
910374012 1:86549629-86549651 TAAAGATTGTTAAAGTGATATGG + Intronic
911141986 1:94513907-94513929 AAAAGGTTCTTAAATTGGTTAGG - Intronic
912579441 1:110706688-110706710 ACAAGCTTCTGAAAGTGTTGAGG - Intergenic
912588947 1:110794624-110794646 AAAAAATTCTAAAAGTCATCTGG + Intergenic
913694018 1:121306742-121306764 AAACGATTCTCAAAGGGATCTGG + Intronic
914143546 1:144973325-144973347 AAACGATTCTCAAAGGGATCTGG - Intronic
915455756 1:156039640-156039662 AAAAGACTCTTATAGTGGCCGGG + Intronic
915709307 1:157879174-157879196 AAGAGATTTTTAAAGTGTGTTGG - Intronic
916024400 1:160821277-160821299 AAAAGTTTCTGAAAGGATTCAGG - Intronic
916271766 1:162950748-162950770 AAAATGTTCTTAAAATTTTCTGG + Intergenic
916378517 1:164182674-164182696 AAAAAATTCAAAAATTGTTCAGG + Intergenic
916868976 1:168891689-168891711 AACAGATTCTTATAGTGTGTAGG - Intergenic
917824821 1:178807629-178807651 AAAGGTTTCTTCAAGTGTTTGGG + Intronic
919012625 1:191984517-191984539 AAAACATACTTAAAGTTGTCAGG + Intergenic
919276051 1:195418114-195418136 AAAATATACTTAAAGAGTCCAGG + Intergenic
920481343 1:206325121-206325143 AAACGATTCTCAAAGGGATCTGG + Intronic
920796960 1:209148088-209148110 TAGAGAGTCTTAAATTGTTCTGG - Intergenic
921817365 1:219579046-219579068 AGTAAATTCTTAAAGTCTTCTGG - Intergenic
923375176 1:233354678-233354700 AATGGATTCTTAAAATCTTCAGG + Intronic
924117895 1:240765756-240765778 TTAAAATTCTTAAAGTGTTTAGG - Intergenic
924505938 1:244683712-244683734 AAAAAATTCAAAAAGTGTTGGGG - Intronic
924838062 1:247675399-247675421 AAAAAATTCTTAAAGTTCACAGG + Intergenic
1064386306 10:14894921-14894943 AAAACTTTCTTAAAATTTTCAGG + Intronic
1066348094 10:34609049-34609071 TAAAGATTTTTTAAATGTTCTGG - Intronic
1068223839 10:54080743-54080765 AAAACATTTTTAAAATGTACAGG - Intronic
1068385077 10:56316337-56316359 AGAATCTTCTTAAAGTGTTCAGG - Intergenic
1069315697 10:67098030-67098052 AAAAGATTCTTTTATTTTTCAGG - Exonic
1070439579 10:76430318-76430340 AAAAGATTCTTGAACTCCTCTGG - Intronic
1071380974 10:85059160-85059182 AAAAGATGCACAAAATGTTCAGG + Intergenic
1071921773 10:90358387-90358409 AAAAGATTGTTAAAAAGTCCTGG - Intergenic
1071987908 10:91071263-91071285 AAAAGATCCTTCAATTGTTTTGG - Intergenic
1072277942 10:93840843-93840865 GAATGATTCTTAATGTTTTCTGG - Intergenic
1073734488 10:106330286-106330308 CAAAGCTTCTTTAAGTGGTCAGG - Intergenic
1073985342 10:109202150-109202172 AATAGATCCATAAAGTCTTCTGG + Intergenic
1074094559 10:110299224-110299246 TAAAGCTGCTTAAAGTGTTTTGG - Intronic
1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG + Intergenic
1079036263 11:17022754-17022776 AAAAACATCTTAAAGTGTTGGGG - Intergenic
1079827523 11:25215205-25215227 AAAAGCTTCTGAAAGTGTAGAGG + Intergenic
1083015407 11:59448065-59448087 AAAAAACTCTTAATGTGTTAAGG + Intergenic
1084249383 11:67884731-67884753 TAAAGTTTCTTTAAGAGTTCAGG + Intergenic
1084823426 11:71710757-71710779 TAAAGTTTCTTGAAGAGTTCAGG - Intergenic
1086134270 11:83431081-83431103 AAAATAGTGTTAAAGTGTTGGGG + Intergenic
1087005653 11:93468090-93468112 AAAAGTTTCTTAGAGTTTACTGG - Intergenic
1087110044 11:94455733-94455755 AAAAGAAACTTAAAGTGTTTTGG - Intronic
1087404637 11:97715555-97715577 GACAGAATCTTAAAGTGTTATGG - Intergenic
1087479012 11:98675859-98675881 AAAAGATTCTTAAATTCATATGG - Intergenic
1090966299 11:131600222-131600244 AAGAGATTCATAAAGTGTCTGGG + Intronic
1092110733 12:5962293-5962315 AAAAAATGTTTAAAGTGTGCCGG - Intronic
1092419673 12:8320137-8320159 TAAAGTTTCTTTAAGAGTTCAGG + Intergenic
1092980413 12:13789047-13789069 AAAGGCTTCTTAAAGAGTCCTGG + Intronic
1093061445 12:14611526-14611548 AGAAAAATCTTAAAGAGTTCAGG - Intergenic
1093675771 12:21938877-21938899 AAAATGTTCTTAAATTTTTCAGG - Intronic
1094773899 12:33699025-33699047 TAGGGAATCTTAAAGTGTTCAGG + Intergenic
1097503283 12:60433452-60433474 AAAACCTTCTAAAAATGTTCAGG - Intergenic
1097740205 12:63233144-63233166 AAAAGATTCTCAAAGTGCTTAGG - Intergenic
1098005769 12:65995404-65995426 ACATTATTATTAAAGTGTTCCGG + Intergenic
1098498049 12:71159821-71159843 AAAAGAATTTTAAAGTGCTAAGG - Intronic
1098640468 12:72832735-72832757 AAGAGAGTCTAAAAGTGTTCTGG + Intergenic
1098947745 12:76607114-76607136 ACAAGCTTTTTAAAGTCTTCAGG - Intergenic
1100023352 12:90098046-90098068 AAAAGATTATTTATGTGTGCAGG + Intergenic
1100142916 12:91640878-91640900 AAAAGACTCTTTTAGTATTCAGG + Intergenic
1100313638 12:93422040-93422062 AAGACATTTTTAAAGTTTTCTGG + Intronic
1100336734 12:93638584-93638606 GAATGATTCTTAAAGAGTTCTGG + Intergenic
1100945996 12:99784472-99784494 AAATGATTATGAAAGTGTTCAGG - Intronic
1101261466 12:103035669-103035691 AAAATATTCTTCAAGAGTTAGGG - Intergenic
1103185924 12:118957306-118957328 ACAAAATTCTTTAAGTTTTCAGG + Intergenic
1104196579 12:126545368-126545390 AAAAGATTTTTAAAATGTCTAGG + Intergenic
1104620252 12:130306432-130306454 AAAAGATTCTCAATGTGGGCCGG - Intergenic
1106154203 13:27137267-27137289 TAAACATAATTAAAGTGTTCAGG - Intronic
1106286111 13:28319294-28319316 AAAAAACTCTTAAAGTGTAATGG - Intronic
1106755327 13:32817376-32817398 AAAAAATTCTTAAATTGATATGG + Intergenic
1107697944 13:43018800-43018822 AAAAAATGGTTAAAGTGTCCAGG - Intergenic
1109685637 13:65816136-65816158 ATAAGATTTTTACATTGTTCAGG - Intergenic
1109995362 13:70116576-70116598 AAAAGATCCTGTAAGTGATCTGG - Intergenic
1110489207 13:76083466-76083488 AAAATATTTTTAAAGTTTTTTGG + Intergenic
1110522905 13:76501835-76501857 AAAGAATTCTTAGACTGTTCTGG - Intergenic
1111123753 13:83885952-83885974 AAATCATTTTTAAAGTGTTTTGG - Intergenic
1111186062 13:84737250-84737272 AAGAGATTATTATAGTTTTCAGG - Intergenic
1111528122 13:89500253-89500275 AAAAGCTTCTAAAAATTTTCAGG - Intergenic
1113430638 13:110247416-110247438 AAAAGTCTCTTAAACTTTTCAGG + Intronic
1115215217 14:31007373-31007395 AAAAGATTCTACAACTGTTAGGG - Intronic
1115692527 14:35859514-35859536 AGAAGATCCTAAAAGTATTCAGG - Intronic
1115855270 14:37623671-37623693 AAAAGATTGGCACAGTGTTCTGG + Intronic
1116665428 14:47768063-47768085 AAAAGCTTCTTTTAGAGTTCTGG - Intergenic
1117721624 14:58634336-58634358 AAAAGATGTTTAAAATTTTCAGG + Intronic
1118932936 14:70259164-70259186 TAAACATTCTTAAAGTGTATTGG + Intergenic
1119057666 14:71439614-71439636 AAAAGAATATTAAAGTGTCATGG + Intronic
1119068916 14:71560688-71560710 AACAGATTCTCAAGTTGTTCAGG - Intronic
1120599677 14:86486249-86486271 AAAATATTTTTAAAGTATTTGGG - Intergenic
1120825516 14:88951278-88951300 AAATTACTCTTTAAGTGTTCTGG + Intergenic
1121360724 14:93256265-93256287 AAAACATTATAAAAGTCTTCTGG - Intronic
1124326586 15:28769599-28769621 AAAAGAATAATAAAGTATTCTGG - Intergenic
1124915694 15:33970754-33970776 ACAATATTCCTTAAGTGTTCTGG + Intronic
1124967209 15:34443726-34443748 AAAAGTTTCTGAAAATGTACTGG + Intergenic
1126076798 15:44919151-44919173 AAAATATTCTTAGAATGTTAAGG + Intergenic
1126446860 15:48756877-48756899 AAAAGATACTTAATTTGTTGGGG - Intronic
1127058184 15:55153837-55153859 TAAATATTGTTAAAGTTTTCTGG - Intergenic
1127591359 15:60427378-60427400 AAATGACTCTGAATGTGTTCAGG - Intronic
1128898899 15:71401165-71401187 AAAATATTGCTAAAGTGTTGAGG - Intronic
1130181541 15:81634258-81634280 AAATGATTCTAAAATTATTCTGG - Intergenic
1130225362 15:82053820-82053842 TAATGCTTCTTAAAGTTTTCTGG - Intergenic
1130236275 15:82137257-82137279 AAACTCTTCTTAAAGTGTTCTGG + Intronic
1130293650 15:82626490-82626512 ATAAGAATGTTGAAGTGTTCTGG - Intronic
1131437737 15:92436483-92436505 AAAAGATTCTGCAAGTGATTTGG + Intronic
1131569337 15:93518441-93518463 AAAAAATTCTTCATATGTTCTGG - Intergenic
1135880996 16:26257015-26257037 AAATTATTCTTAAATTGATCTGG + Intergenic
1138592390 16:58008862-58008884 AAAATATTTATAAAGTTTTCTGG + Intronic
1140347301 16:74226645-74226667 GAAAGTTTCTTAAATTTTTCTGG - Intergenic
1140938218 16:79695817-79695839 AAAAAAGACTTAAAGGGTTCAGG + Intergenic
1144844211 17:18207673-18207695 AAAATATTTTTTAAGTGTTGGGG + Intronic
1145825041 17:27870555-27870577 TGAAAATTCTTAAAGTTTTCTGG - Intronic
1147378985 17:40041127-40041149 AGAAGATTCATAGAGTGGTCAGG - Intronic
1148254761 17:46120210-46120232 AAAAGAATCTTAAACTGTTGAGG + Intronic
1149746339 17:59102797-59102819 AAAAAATTATTTAAGTGTTACGG + Intronic
1149888409 17:60363984-60364006 AAAACATGCTTAATCTGTTCAGG + Intronic
1150268424 17:63846454-63846476 AAAATATCCTTAAGGTGTTAGGG + Intergenic
1150529720 17:65964376-65964398 TAAAGAATTTTAAATTGTTCTGG + Intronic
1153238637 18:3012365-3012387 AAAAGAGTCTTAAAATGTTCAGG + Intronic
1154394175 18:13971688-13971710 AAAATATTCTTGAATTGTTGTGG + Intergenic
1155485471 18:26337141-26337163 AAAATATTTTGAAAGTTTTCTGG + Intronic
1156562686 18:38146311-38146333 AAAGGCTCCTTAAAGTGCTCAGG - Intergenic
1156803091 18:41142516-41142538 AACAGATTCTAAATGTATTCTGG - Intergenic
1157312784 18:46564854-46564876 AAAAGATATTCAAAGAGTTCTGG + Intronic
1157842854 18:50975710-50975732 GAAAGATACTTCTAGTGTTCAGG + Intronic
1158127769 18:54120985-54121007 AAAAGATTTTTAAAGTGGCATGG - Intergenic
1158590596 18:58775617-58775639 AAAAAATTCTTAGATAGTTCTGG - Intergenic
1158872588 18:61702750-61702772 AATAGTTTCATAAAGTTTTCAGG - Intergenic
1159233437 18:65639194-65639216 CAAAGATTCTGAAAGTGCTATGG + Intergenic
1159631527 18:70754221-70754243 AAAAGAGTTTCAAAGTGTCCAGG - Intergenic
1160747294 19:718198-718220 AAAAGATAAGTAAAGTGATCCGG + Intronic
1162996229 19:14337457-14337479 GAAGGGTTCTTCAAGTGTTCTGG - Intergenic
1163332226 19:16647163-16647185 AAAACATTCTTGAAGTCATCAGG + Exonic
1163986298 19:20954008-20954030 AAAAGATGGTTACAGTGTGCAGG + Intergenic
1165335612 19:35167570-35167592 AAAAGGTTTTTAAAATGTTGTGG + Intronic
1168572798 19:57483864-57483886 AAAAAATTCTTCCAGTGATCTGG + Intergenic
926360054 2:12078497-12078519 TAAATATTTTTAAAGTGGTCTGG + Intergenic
926879728 2:17530958-17530980 AAAATTTTCATAAAGTTTTCAGG + Intergenic
928539531 2:32271356-32271378 TAAGGATTCTTGAAGTATTCTGG + Intergenic
929198887 2:39214354-39214376 ATAAAATTCTCAAAGTGGTCAGG - Intronic
929214015 2:39391446-39391468 AAAAGATTCTGAAAGTTCTGTGG + Intronic
930523765 2:52499978-52500000 AAAAGATTCTAAATATATTCTGG + Intergenic
930828494 2:55718068-55718090 AATAGATTGTTAAAGTGCTTTGG + Intergenic
930976463 2:57467977-57467999 AAAAGATTCTAAAATTTTTGTGG - Intergenic
931342237 2:61413067-61413089 TAAAGATTCTAAAAGCTTTCAGG + Intronic
931663080 2:64587156-64587178 AATAGCTTCTTAAAGTGATAGGG - Intronic
932535028 2:72583689-72583711 AAAAGACCCTTAAAGTTCTCTGG + Intronic
933134242 2:78711669-78711691 AAAAGACTCTTAGAGAATTCAGG + Intergenic
933890834 2:86768226-86768248 AACAGTTTCTTAAAATGTTTTGG - Intronic
936446687 2:112601678-112601700 AACACATTCTCAAATTGTTCAGG - Intergenic
936847172 2:116850997-116851019 AAAATATTCTTAATGTATCCAGG + Intergenic
937050631 2:118885586-118885608 AAAACATCCTTAAAGTGCTTTGG - Intergenic
939804502 2:146756040-146756062 AAAAGATTCTTAATGTTTTCTGG + Intergenic
939892330 2:147751742-147751764 GAAAGATTTTTAAAATGTACTGG - Intergenic
940107819 2:150118052-150118074 AAAACAGTGTTAAAGTGTTGGGG - Intergenic
940113592 2:150182599-150182621 AAAAGATGTTTAACATGTTCTGG + Intergenic
940214193 2:151288026-151288048 AAAAGATGCCAAAAGGGTTCTGG - Intronic
941362975 2:164575460-164575482 TAACGATTCTTAAATTGTTATGG - Intronic
941586463 2:167365107-167365129 AAAAAATTCCCAAACTGTTCTGG - Intergenic
943403381 2:187447071-187447093 ATTAGTTTCTTAAATTGTTCAGG + Intronic
943422755 2:187689151-187689173 AATTGATTCATAAAGTATTCAGG - Intergenic
943760297 2:191600800-191600822 ATAAGATTCTCAAAGGGATCTGG - Intergenic
943816308 2:192260904-192260926 AAAGTATTATTAAAGTGTTTGGG + Intergenic
943965952 2:194332834-194332856 AAAATATTCTGAAAGAGTTGAGG - Intergenic
944296157 2:198065227-198065249 AGAAGTTTCCTAAAGTATTCTGG - Intronic
946680933 2:222215305-222215327 AAATGATTCTTCAAATGTTTTGG - Intronic
947884887 2:233560647-233560669 AAAAGTTTCTTACCATGTTCAGG - Intronic
1171047938 20:21828274-21828296 AAAAGCTTCTTAAGGGTTTCAGG + Intergenic
1172135336 20:32682922-32682944 GGCAGATTCTTAAAGTGGTCAGG - Intergenic
1175556240 20:59859381-59859403 TATAGTTTCTTAAATTGTTCTGG - Intergenic
1177300672 21:19241539-19241561 TAAAGTGTCTTAAAGTGATCAGG - Intergenic
1179122137 21:38557758-38557780 AAAAGACTCTTAGAATGTTCTGG + Intronic
1184276884 22:43413706-43413728 AAAAGATTTTACAAGTGTTGTGG - Intronic
1184811260 22:46833954-46833976 AAAAGACTTTTAAAATGTTAAGG - Intronic
949301481 3:2589257-2589279 AAACCATTCTTAAAGTCTTGGGG + Intronic
950267338 3:11584032-11584054 AAAAGCCTCGTAAAATGTTCTGG - Intronic
950343446 3:12269793-12269815 AAAAGATTCTTAAATATCTCAGG - Intergenic
951004767 3:17603133-17603155 AAAAGATTCTTTAAGTTTTTTGG + Intronic
951030882 3:17880632-17880654 AAAAGAAACTTAAGGAGTTCAGG - Intronic
951097299 3:18646822-18646844 AAAAGAATCTCATAGTGTTAGGG + Intergenic
952944283 3:38467036-38467058 TAAAGATTCTTACAATGTCCAGG + Intronic
953022176 3:39121646-39121668 AAAAGATTTTTAAAGTCACCTGG - Intronic
953553172 3:43920712-43920734 AAAAGATTCTAAAAGCCTCCAGG - Intergenic
955915165 3:63900445-63900467 AACAGCCTCTTAAAATGTTCTGG + Intronic
956143682 3:66171180-66171202 AAAATATTCATAATGTCTTCAGG - Intronic
956809388 3:72849537-72849559 AAAAGACTTTTGAAGTTTTCTGG - Intronic
957108854 3:75926628-75926650 TAAAGGTTCTTAAGGTGTTAAGG + Intronic
957220538 3:77376697-77376719 AAAAGATGCTTAAAATATGCAGG - Intronic
957370023 3:79281824-79281846 AAAAGATGCTTAAAGTAATATGG + Intronic
957399742 3:79694117-79694139 TTAAGATTCATAAAGTCTTCAGG + Intronic
957674455 3:83348349-83348371 AAATGATTATTAAAGAGTTGGGG - Intergenic
958585083 3:96076737-96076759 AAACTATTTTTAAAGTGTGCTGG - Intergenic
958589001 3:96129578-96129600 AAAATATTCTAAAATTGGTCTGG + Intergenic
959071990 3:101710854-101710876 AACAGCTGCTTAAAGTGTTAAGG - Intergenic
959577590 3:107950873-107950895 AAAAGCTTCTTAAATTGTATAGG + Intergenic
960237314 3:115298747-115298769 CAAAGATTTCAAAAGTGTTCTGG + Intergenic
961289750 3:125836673-125836695 TAAAGTTTCTTTAAGAGTTCAGG - Intergenic
961897358 3:130179326-130179348 TAAAGTTTCTTTAAGAGTTCAGG + Intergenic
963016126 3:140825875-140825897 TAAAGATACTTAAAGTATTTTGG + Intergenic
964257921 3:154798486-154798508 AATAGATTCTTAGAGTATTTGGG - Intergenic
965542755 3:169886881-169886903 CAGAGATTCCTAAAGTGTCCTGG - Intergenic
965766765 3:172138733-172138755 AAAAGATTCCTAAATTATTTTGG - Intronic
966468020 3:180253910-180253932 AACAGAGTTTTAAAGCGTTCTGG - Intergenic
969209263 4:5674049-5674071 AAATGATTCTTAGACTGTTCCGG - Intronic
969241969 4:5905005-5905027 GAAAGAATCTTACAGTGTTCAGG + Intronic
969805447 4:9604597-9604619 TAAAGTTTCTTTAAGAGTTCAGG - Intergenic
970410491 4:15802431-15802453 AAAAGATTCTTAAATTTGTTAGG + Intronic
970944680 4:21677403-21677425 AAAAGTTGCTCAATGTGTTCAGG + Intronic
971718137 4:30208164-30208186 AAAAGGTTAATATAGTGTTCAGG - Intergenic
973178440 4:47238146-47238168 AAAAGTTTCTTTACATGTTCAGG - Intronic
974397453 4:61356895-61356917 AAAACAGCCTGAAAGTGTTCAGG - Intronic
974546027 4:63307935-63307957 AATAGATTATCAAAGTATTCTGG + Intergenic
974715606 4:65667171-65667193 AAAATATTCATAAAATGTTTGGG - Intronic
975951579 4:79778450-79778472 AAAGGTTTCTTACACTGTTCTGG + Intergenic
976868076 4:89755427-89755449 AAAAGATTTTTATGGAGTTCAGG + Intronic
977010710 4:91629190-91629212 AAAATATTGTTGAAGTGTTGGGG - Intergenic
977012506 4:91655089-91655111 AAAATATTGTTGAAGTGTTGGGG + Intergenic
977074780 4:92439440-92439462 AAAATAATGTTAAAGTGTTGGGG + Intronic
977732220 4:100367495-100367517 AAAATATTCTGAAAATATTCTGG - Intergenic
978879328 4:113681632-113681654 AAAATAATCTTGAAGTTTTCTGG - Intronic
978996226 4:115156934-115156956 AAAAGATTTTTAATGTGATATGG + Intergenic
979578731 4:122329387-122329409 ACAAGATTCTAAAAATGTCCAGG - Intronic
979808873 4:125011055-125011077 AAAAGCTTCTTAGCGTCTTCTGG - Intergenic
980746051 4:137017732-137017754 CAAAGTTTCTTAAAGTCTTTTGG + Intergenic
980833999 4:138167445-138167467 AAAAGATTTTTAAATAGGTCCGG - Exonic
981298279 4:143157358-143157380 AAAAGATTTTGTAAGTGTTGTGG + Intergenic
981651619 4:147065837-147065859 AAAATATTCTAAAAGTGTCTTGG - Intergenic
981942862 4:150303874-150303896 CAAAGATTCTTAAAGGGTGAGGG - Intronic
982145251 4:152381233-152381255 AAAATATTCTTCCAGTGTTATGG + Intronic
982638675 4:157928626-157928648 TAAAGATTCTCAAGGTATTCTGG - Intergenic
983158529 4:164382819-164382841 AAAAGATTCTGAACCTGCTCAGG - Intronic
984228760 4:177067521-177067543 AAAAGAATCTATAAGTTTTCTGG + Intergenic
985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG + Intronic
985905816 5:2835311-2835333 AAAAGATTCTGAAAGACTGCTGG - Intergenic
986810031 5:11346989-11347011 AGAAGATTCAGAATGTGTTCCGG + Intronic
987628137 5:20430077-20430099 AAAATATTCGTAGAGTGTTATGG - Intronic
987737176 5:21861047-21861069 AAAAGGTCCTGAAAGTGTTGAGG + Intronic
987952470 5:24693074-24693096 AAAAGAGTCTTTAAGAATTCTGG + Intergenic
988021001 5:25621436-25621458 AAAATATTCTAAAAGTGGCCAGG - Intergenic
988861385 5:35283977-35283999 AGAATATTCTTTAATTGTTCAGG - Intergenic
989104892 5:37853072-37853094 AAAAGAATCTTAGAGTTTTGAGG - Intergenic
989518101 5:42367023-42367045 AAAATATTCTAAAAATATTCAGG - Intergenic
989800524 5:45533022-45533044 AAATGAGTCTTAATGAGTTCAGG + Intronic
990207503 5:53445069-53445091 AAAAGATTATTAGAATGGTCAGG + Intergenic
990271085 5:54139889-54139911 AAAAGATGCTTAAAGTCTTTAGG - Intronic
990829858 5:59944051-59944073 AACAGATCCTTAAAGTGTCCAGG + Intronic
991058954 5:62350922-62350944 AAAAGATTTTTAAAATGTATGGG + Intronic
992246882 5:74835035-74835057 TAATTGTTCTTAAAGTGTTCAGG - Intronic
992413472 5:76530841-76530863 AATGGATTCTTAAAGTTTACAGG - Intronic
993060970 5:83038717-83038739 ACTATATTATTAAAGTGTTCAGG + Intergenic
993335200 5:86648641-86648663 AAAAGTTTTTGAAAGTGTTTGGG + Intergenic
993338261 5:86689111-86689133 GGAAGATTCTTAAAGTTTTGTGG + Intergenic
993700205 5:91110190-91110212 ATAAGTTTCTTAAACTATTCAGG + Intronic
994322754 5:98411956-98411978 AAATAATTCTTAAAATGTCCAGG + Intergenic
995508416 5:112884031-112884053 AAAAGGTTCTTGCAGTGATCTGG - Intronic
996802782 5:127422071-127422093 AAAAAATTTTTAAAGTGTGTTGG + Intronic
999159336 5:149482441-149482463 AAGAGCTACTTCAAGTGTTCAGG + Intergenic
1001936417 5:175708983-175709005 AAAAGCTGCTTAGAGTGGTCAGG - Intergenic
1002347912 5:178560888-178560910 AAAAGATCCTTAAACTCTACAGG + Intronic
1002714852 5:181220475-181220497 AAAACATTCTTAAAGGATTCTGG - Intergenic
1003028739 6:2581656-2581678 AAAAGAATCTTAGAGTATTTTGG - Intergenic
1003193748 6:3896534-3896556 AAAAGATTCTTAAATGGGTGTGG + Intergenic
1003305051 6:4919587-4919609 AAAAAATTCTTCGAGTTTTCAGG + Intronic
1008488044 6:52056302-52056324 AAGAAATTCTTAAAATGTTAGGG - Intronic
1009683787 6:66929841-66929863 GAAAAATTCTTAAAGTTTTTTGG + Intergenic
1011348808 6:86400327-86400349 AAAACATTCAAAAAGTGATCTGG - Intergenic
1011899844 6:92278682-92278704 AAAAGTCTCATAATGTGTTCAGG + Intergenic
1013850778 6:114512380-114512402 AAAATATTTTTAAAATTTTCAGG + Intergenic
1014873296 6:126623752-126623774 AAAAGATTCTAAAAGCTTGCAGG - Intergenic
1016137664 6:140565527-140565549 AAAAAATTTTTAAAGTGGTCAGG - Intergenic
1016345844 6:143113302-143113324 AAAAAATTATTAAAGATTTCTGG + Intronic
1016789584 6:148054157-148054179 AAAAGGTTGTTAAACTGTTTAGG - Intergenic
1017934950 6:158997442-158997464 AAAATATTTTTTAAGTGTTCAGG - Intronic
1018274572 6:162117149-162117171 AAAAGCTTCTTAAAGTGGGAAGG + Intronic
1018537814 6:164840406-164840428 AAGAGATTCTAAAATTGTTTTGG - Intergenic
1020328040 7:6991013-6991035 TAAAGTTTCTTTAAGAGTTCAGG + Intergenic
1020670971 7:11111583-11111605 AATATATTCTTAAGGTGTACTGG - Intronic
1021117490 7:16760339-16760361 AATAGATTCTGAGAGTGTTTTGG + Intronic
1021489644 7:21205032-21205054 AAAAGGTTCTAAAAGTTTTCTGG + Intergenic
1022246670 7:28566958-28566980 AGAAGATTCTTAAACTTTTGGGG + Intronic
1022825051 7:34000538-34000560 AAAGGAATCTTAAATGGTTCAGG + Intronic
1023180744 7:37480873-37480895 AAAACATTCTCCGAGTGTTCAGG + Intergenic
1024469993 7:49758311-49758333 AAAATATTTTTAAATTATTCTGG - Intergenic
1024549993 7:50554872-50554894 AAAAGCAACATAAAGTGTTCTGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026018631 7:66691902-66691924 AAAAAATTAGTAAAGTGTGCTGG + Intronic
1026633778 7:72062883-72062905 AAAAAATTCTTTAAATGTTTTGG - Intronic
1026997462 7:74627329-74627351 TAAATATTTTTAAATTGTTCCGG - Intergenic
1027802621 7:82774556-82774578 AAAAAATTATTAAAGTATTTTGG - Intronic
1028342528 7:89739350-89739372 AAAATATTCTTAAAATGTCCCGG + Intergenic
1028820387 7:95203980-95204002 ACAAGATATTTAAAGTGTTAGGG - Intronic
1029141727 7:98415963-98415985 AAAAAATTCTTAACCTGTTGTGG + Intergenic
1030744517 7:113148864-113148886 AAAATATTTTTAAATTGTTGTGG - Intergenic
1031144295 7:117980681-117980703 AAAACCTTCTTAATGTGTTAGGG + Intergenic
1031286609 7:119877567-119877589 AAAATATTCTGAAGATGTTCAGG + Intergenic
1031573575 7:123388473-123388495 GAAAGATTCTTAAAGTCTATGGG - Intergenic
1032334670 7:131014008-131014030 AACACATTCTTAAAATGTGCAGG - Intergenic
1032680790 7:134180667-134180689 AAAATATTTTTAATGTTTTCAGG - Intronic
1037106574 8:15115667-15115689 AAATAATTCTTAATATGTTCTGG + Intronic
1037107022 8:15121362-15121384 ACACGATTCTTAAAATATTCTGG + Intronic
1038251006 8:25904210-25904232 ACCAGATTCTTAAAGGGGTCTGG + Intronic
1038994450 8:32906029-32906051 AAATGATTCTTAAGGTTTTCTGG - Intergenic
1041340152 8:56836686-56836708 AAAAGATCCTTAAAATATTGAGG + Intergenic
1041647445 8:60267811-60267833 AAAAGTTTTTTAGATTGTTCTGG - Intronic
1042043129 8:64616557-64616579 AAAGGATATTTAAAGTGTTCAGG - Intronic
1042373186 8:68016776-68016798 CAAAGATTTTTAAAGTTTGCTGG - Intronic
1043058544 8:75471103-75471125 AAAAAATGCTTTAAGAGTTCAGG + Intronic
1043473187 8:80581237-80581259 AAAAAATTGCTAATGTGTTCTGG - Intergenic
1044301258 8:90586193-90586215 AAAAAATGTTTTAAGTGTTCAGG + Intergenic
1044876671 8:96674717-96674739 ATAAGATTCTCAAAGTTTTATGG - Intronic
1046016279 8:108609344-108609366 AAACTATTCTTAAAATATTCAGG + Intronic
1047504927 8:125471850-125471872 AAAAGATGCTAAAAATGTTTAGG + Intergenic
1048481647 8:134801445-134801467 CAAAGATTTTTAAAGTTTGCTGG - Intergenic
1048722596 8:137343744-137343766 GAAAGAGTGTTAAAGTGTTGAGG + Intergenic
1049627542 8:143632468-143632490 AAAAGATTTTTAAAATCTGCTGG - Intergenic
1050836692 9:10089814-10089836 AAAAGATTTTACAAGTTTTCTGG - Intronic
1051139388 9:13962179-13962201 AAAAAAGTTTAAAAGTGTTCAGG - Intergenic
1051433113 9:17000961-17000983 AACAGATTCTTCAAGTGTGTTGG - Intergenic
1053709365 9:40789936-40789958 TAAATATTCTAAAAGTGGTCGGG - Intergenic
1054419273 9:64910739-64910761 TAAATATTCTAAAAGTGGTCGGG - Intergenic
1055185583 9:73449278-73449300 GAAAGATTCTTTATATGTTCTGG + Intergenic
1055221796 9:73943086-73943108 AACAAATTCTTATAGTGGTCTGG - Intergenic
1056298751 9:85220506-85220528 GCAAGATTCTTAAAGTGTGGTGG + Intergenic
1057241264 9:93412364-93412386 AAAAGAATCTTAAAATTTGCTGG - Intergenic
1059201288 9:112419506-112419528 AAAAGATTCTTAAAGTGTTCCGG - Intronic
1061738577 9:132681566-132681588 AAAAGTGTCTAAAAATGTTCGGG - Intronic
1062693720 9:137860056-137860078 TAAAGATTCTAAAAGAGATCAGG - Intronic
1186658537 X:11643430-11643452 AAAAAATTTATAAAGTGTTTTGG - Intronic
1186674661 X:11803787-11803809 AAAAGAATCTTACAGTGGACAGG - Intergenic
1187757464 X:22543685-22543707 AATAGATTCTTTAAGTATACAGG - Intergenic
1187877765 X:23818169-23818191 AAAATATACTTAGAGAGTTCAGG - Intergenic
1188121030 X:26307877-26307899 AAATTAATATTAAAGTGTTCAGG + Intergenic
1188553863 X:31389759-31389781 AAAGGATTCTTAAAGTATATTGG - Intronic
1188913699 X:35883178-35883200 AATAGATTCCAAAAGTATTCAGG + Intergenic
1189136066 X:38551611-38551633 AAAATAGTGTTGAAGTGTTCGGG - Intronic
1189554154 X:42125017-42125039 AAAAGACTATTCAAGGGTTCAGG - Intergenic
1192779676 X:74281569-74281591 AAAAAAGTCTTAAAATATTCAGG - Intergenic
1193742897 X:85240355-85240377 AAAAGTTTATTAAGGAGTTCAGG - Intergenic
1195068710 X:101259921-101259943 AAAAGCTTCTTAAAGTCTAAGGG + Intronic
1197079943 X:122400273-122400295 AATATATTCTTAAAGAATTCTGG - Intergenic
1197106109 X:122718381-122718403 AAAATATTTTTTAAGTATTCTGG - Intergenic
1198518841 X:137432661-137432683 TAAAGACTCTTAAAATGTTATGG - Intergenic
1200952177 Y:8908903-8908925 AGGAGATTCTTAGAGTTTTCAGG + Intergenic