ID: 1059204334

View in Genome Browser
Species Human (GRCh38)
Location 9:112449786-112449808
Sequence TCATGTCACTGCACTCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059204332_1059204334 7 Left 1059204332 9:112449756-112449778 CCAGGAGGTGGAGGTTGCAGTGA No data
Right 1059204334 9:112449786-112449808 TCATGTCACTGCACTCCAGACGG No data
1059204331_1059204334 8 Left 1059204331 9:112449755-112449777 CCCAGGAGGTGGAGGTTGCAGTG No data
Right 1059204334 9:112449786-112449808 TCATGTCACTGCACTCCAGACGG No data
1059204328_1059204334 16 Left 1059204328 9:112449747-112449769 CCCAGCTGCCCAGGAGGTGGAGG No data
Right 1059204334 9:112449786-112449808 TCATGTCACTGCACTCCAGACGG No data
1059204330_1059204334 15 Left 1059204330 9:112449748-112449770 CCAGCTGCCCAGGAGGTGGAGGT No data
Right 1059204334 9:112449786-112449808 TCATGTCACTGCACTCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059204334 Original CRISPR TCATGTCACTGCACTCCAGA CGG Intronic