ID: 1059205213

View in Genome Browser
Species Human (GRCh38)
Location 9:112458081-112458103
Sequence CAGTGGCACTAGAAGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059205213_1059205217 22 Left 1059205213 9:112458081-112458103 CCATCTACCTTCTAGTGCCACTG 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1059205217 9:112458126-112458148 ACGTGCTGCACTCTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059205213 Original CRISPR CAGTGGCACTAGAAGGTAGA TGG (reversed) Intronic
903399552 1:23030907-23030929 CAGTGGCAATATAAGGTGGTTGG + Intronic
905581022 1:39082469-39082491 CCCTGGCACTAGAAGGTAATGGG + Intronic
905842163 1:41190810-41190832 CAGTGCCAGTAAATGGTAGATGG - Intronic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
906591003 1:47023980-47024002 CTTGGGCACCAGAAGGTAGATGG + Exonic
908709167 1:66995661-66995683 CAGAGGCCCTAGAAGGTGGGTGG + Intergenic
909751080 1:79161875-79161897 CAGAGGGAATAGCAGGTAGAAGG + Intergenic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
911003104 1:93188569-93188591 AAGTGGCACTGGAAGATAGAAGG - Intronic
916186898 1:162142237-162142259 CAGTGGCTCTGTAAGGAAGATGG + Intronic
920664440 1:207951179-207951201 AAGTGGTAGTGGAAGGTAGAGGG - Intergenic
921279611 1:213552883-213552905 CAGTAGTGCTTGAAGGTAGAAGG - Intergenic
921944518 1:220877618-220877640 AAGTGGCACTAGAAAGCAGAGGG + Intergenic
922415104 1:225414220-225414242 GACTGGCACTAAAAGGCAGAAGG + Intronic
1065012579 10:21432805-21432827 CAGAGGCCCTAGAAGGCAGAGGG + Intergenic
1065841036 10:29701233-29701255 TAGTAGCACTAGAAGAAAGATGG + Intronic
1069063599 10:63919638-63919660 CATTGGCTCTTGAAGGTTGAAGG + Intergenic
1069140155 10:64812030-64812052 CAGTGCCACTAGGATTTAGAAGG + Intergenic
1069506001 10:68998635-68998657 TAGTGGCAAAAGATGGTAGAAGG + Intronic
1070483198 10:76905367-76905389 CAGTGGCATTAGGAGGAAGCTGG + Intronic
1071850524 10:89564634-89564656 TAATAGTACTAGAAGGTAGAAGG + Intergenic
1072817873 10:98527459-98527481 CAGGGGCCTTAGAAGGGAGAGGG - Intronic
1073763139 10:106652339-106652361 CACTGGCCCTAGAAAGTAGGGGG + Intronic
1074366868 10:112865027-112865049 CAGTGGCTATAGAAGGCACAAGG - Intergenic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1079683823 11:23331740-23331762 CAGTGGGACTGGCAGGTAGGTGG + Intergenic
1081465321 11:43311653-43311675 CGGTGGCACTAGAGGCTAGTGGG - Intergenic
1085340313 11:75727126-75727148 CAGTAGCCCTAGGAGGTAGCAGG + Intronic
1088607913 11:111548911-111548933 CAGTGGCACTTGAAACTAAATGG - Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089786741 11:120912845-120912867 CAGTGTCAGTAAAAGGTAGGCGG + Intronic
1090199865 11:124846331-124846353 CAGTGGCACTAATAGGGAGGGGG - Intergenic
1095644704 12:44529801-44529823 AAGTGTCACTGGAAGGAAGAAGG + Intronic
1098789501 12:74803781-74803803 CATTGGCTATAGAAGGGAGAGGG + Intergenic
1099311341 12:81028348-81028370 CAGTGGCACTAGATCTCAGAGGG + Intronic
1100955736 12:99905859-99905881 CAGTCACATTATAAGGTAGATGG + Intronic
1101404935 12:104419964-104419986 CAGTGTCCCAATAAGGTAGATGG - Intergenic
1104145105 12:126025563-126025585 CACTGGCAGTAGAAGTTAGTGGG + Intergenic
1104535122 12:129611618-129611640 TGGTGGCATTACAAGGTAGAGGG - Intronic
1106816649 13:33415418-33415440 CAGTGGCAGTAGGAGTAAGAGGG + Intergenic
1108326410 13:49336708-49336730 TAGTGGCCCTGGAAGGAAGATGG - Intronic
1109348027 13:61141001-61141023 TAGTGGCACTTCAAGGTAGCTGG - Intergenic
1109390546 13:61685687-61685709 CAGTGGCAGAAAAAGGTAGCAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112281353 13:98065516-98065538 CAGGGCCACTAGAAGGGAGGTGG + Intergenic
1112378892 13:98869841-98869863 CAGTGGCACAGGAAGGAACAAGG - Intronic
1114441397 14:22751190-22751212 CACTGGCACAAGAGTGTAGACGG - Intergenic
1115733135 14:36293687-36293709 CATTGGAACTAGATGGTAAATGG + Intergenic
1116885094 14:50212874-50212896 CAGTAATACTAGAAGCTAGATGG + Intronic
1118318429 14:64739303-64739325 CAATGGCTCTAGAAGGAAAAGGG + Intronic
1118510379 14:66465459-66465481 CAGAGTCACTAAAAGGTACAAGG - Intergenic
1120381175 14:83781713-83781735 GAGTGGCTCTAGAAGAGAGAGGG + Intergenic
1121028290 14:90633683-90633705 CATTGGCCCAAAAAGGTAGAAGG - Intronic
1127630717 15:60825153-60825175 CAGTGGCACAAGAATTTAGAAGG - Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1130903402 15:88223703-88223725 CTGTGGCCCAAGGAGGTAGACGG - Intronic
1130943735 15:88534520-88534542 CAGTGGAACCAGAAGGTACTGGG + Intronic
1132143307 15:99412199-99412221 CAGCAGCACTGGGAGGTAGATGG + Intergenic
1133419532 16:5634105-5634127 CAGTGGCTATAAAAGGTAAAGGG - Intergenic
1133658180 16:7887493-7887515 CAGCTGCACTAAAAGGAAGAGGG + Intergenic
1135805774 16:25541219-25541241 CAGTAGCAATATAAGGTTGAGGG + Intergenic
1137475385 16:48803648-48803670 CAGTGCCACTAGAAGGCACCAGG - Intergenic
1137537838 16:49340955-49340977 CAGTGGCTCAAGATGCTAGAGGG + Intergenic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1146638163 17:34521164-34521186 CAGTGAGTCTAGAAGGTAGGTGG - Intergenic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1148847718 17:50538950-50538972 CAGGAGCACGAGAAGGTAGTGGG + Exonic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1149344878 17:55724636-55724658 AAGTGGTACTAGAAAATAGAGGG - Intronic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1154145211 18:11861266-11861288 CAGGGACCCTAGAAGGAAGAAGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1158493317 18:57929871-57929893 AAGTGGCACAAGAAGGTGGGTGG - Intergenic
1159359992 18:67387897-67387919 CAGTGTCACTAGGAGGTGGCAGG - Intergenic
1168112552 19:54201725-54201747 AAGTGCCACTAAAAGTTAGAAGG - Intronic
1168355103 19:55695580-55695602 CCGTGGCATTAGAAGGGGGAGGG + Intronic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926887724 2:17613189-17613211 CAGTGGAACAAGAAGGTCTATGG + Intronic
927231040 2:20824494-20824516 CAGTGTCACAACATGGTAGAAGG + Intergenic
927391461 2:22600133-22600155 CTGTGGAACTAGGAGGTGGAGGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932105588 2:68938270-68938292 CAGTGGAACTAGATGCTTGAAGG - Intergenic
935397641 2:102624668-102624690 CAGTGACACTTGAAAGGAGATGG - Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
939112320 2:138023079-138023101 CAATGGTACTACTAGGTAGAGGG + Intergenic
940250364 2:151669112-151669134 TAGTTGAACTACAAGGTAGAGGG - Exonic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
944166741 2:196730728-196730750 CAGTAGCACCTGAAGTTAGAAGG + Intronic
944913991 2:204338883-204338905 CAGTGGCAATCTAAGGGAGAGGG - Intergenic
945356547 2:208846713-208846735 CAATGGCATTAGAAAGGAGAAGG + Intronic
946556199 2:220860405-220860427 AAGTGGCAAAAGAAGGTGGAAGG + Intergenic
946784358 2:223226971-223226993 CATTGCCACTAGAAACTAGAAGG - Intergenic
947614792 2:231548882-231548904 CAGGGGCACAAGAAAGGAGAAGG - Intergenic
948189607 2:236047431-236047453 AGGTGGCACGAGAAGGAAGAGGG - Intronic
1169910254 20:10642356-10642378 CAGTGGGACTACAAGGGAAAGGG - Intronic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1174118176 20:48242286-48242308 CATTGTCACTGGAAGGGAGATGG + Intergenic
1174883017 20:54301956-54301978 CAGGGGCTCCAGAATGTAGACGG - Intergenic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1176960002 21:15148583-15148605 CAGATGCACTAGAAGCCAGAGGG + Intergenic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181435693 22:22909378-22909400 CAGTGCCATTAGATGGTATATGG + Intergenic
1182300549 22:29334584-29334606 CGGTGGCCCTAGATGGTACATGG - Intronic
1183897329 22:40979862-40979884 CAGTGGCACTAGAAGAAAAGAGG - Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952935562 3:38395845-38395867 CACTGGCACTAGATGTGAGAAGG - Intronic
955480763 3:59387185-59387207 GAGAGTCTCTAGAAGGTAGAAGG + Intergenic
956311204 3:67882584-67882606 CAGTAGCAAGGGAAGGTAGAAGG - Intergenic
956621381 3:71224378-71224400 CAGTGGCAGAAGAAGGGATAAGG + Intronic
957955312 3:87178680-87178702 CAGAGGGAGAAGAAGGTAGAAGG - Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
960009519 3:112818251-112818273 CAGTGGCCCTAGAAGATACAAGG + Intronic
965353596 3:167646215-167646237 GAGTTGCACCAGAAGGAAGAAGG + Intronic
967959461 3:194908819-194908841 CAGTGGCTCTCCAAGTTAGATGG + Intergenic
968058742 3:195712692-195712714 CAGTGGCACTAGAAAGGGGATGG - Intergenic
969863251 4:10054107-10054129 TAGGGGCACTAGAAAGGAGAGGG - Intronic
974417350 4:61627077-61627099 CAGAGGCAATAAAGGGTAGAGGG - Intronic
974900133 4:67986687-67986709 AAGCAGCACTAGAAGGAAGAAGG + Intergenic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
981703093 4:147628198-147628220 CAGTGGCAGAAGAATGTGGATGG - Intronic
983865844 4:172765614-172765636 CAGTAGCACCAGAAAATAGATGG + Intronic
984021098 4:174485669-174485691 CAGGGGAGCTACAAGGTAGAAGG + Intergenic
986058128 5:4159942-4159964 CAGTGGCCCTACATTGTAGAGGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
995051266 5:107707233-107707255 CACTTTCACTGGAAGGTAGAAGG + Intergenic
998184752 5:139969731-139969753 GGGTGGAACTAGAAGCTAGAGGG - Intronic
1003203551 6:3986710-3986732 CAGTGGAGATAAAAGGTAGATGG - Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1006139943 6:31922327-31922349 CAGTTGCCATAGAAGGTTGAGGG + Intronic
1006380324 6:33693495-33693517 CAGTGGCTCTTGAAGGCTGATGG + Intronic
1007279972 6:40704369-40704391 CTGTGGCATTAGACGGCAGATGG - Intergenic
1009489220 6:64266853-64266875 CAGTAGCAAAAGAAGTTAGAAGG + Intronic
1010690398 6:78904331-78904353 CAGTGGCAATAGGAGGTAAAGGG - Intronic
1013169338 6:107622185-107622207 CAGCAGCTCTTGAAGGTAGACGG + Intronic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1019742105 7:2680164-2680186 CAGTGGCACTTGAAGAAGGAGGG + Intronic
1026501654 7:70947860-70947882 CAGTGGCACTGGTAGTCAGATGG - Intergenic
1027340231 7:77199653-77199675 CAGTGAGACTAGAAAGCAGAGGG - Exonic
1028963617 7:96777033-96777055 CAGTGGCAGTAGCTGGTGGATGG + Intergenic
1030977032 7:116139429-116139451 CAGTGGCTCTTGAACGGAGAAGG - Intronic
1032443101 7:131957496-131957518 CAGTGGCAATTGAATGTAGTGGG - Intergenic
1033440192 7:141371553-141371575 AAGTGGGGCTAGAAGGAAGAAGG + Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1037771534 8:21803334-21803356 CAGTGGGACTAGAAGATATGAGG + Intronic
1039243656 8:35584169-35584191 TAGTGACAATTGAAGGTAGAAGG + Intronic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1046549351 8:115694083-115694105 CAGTGGCATTAGATGTGAGATGG - Intronic
1047390558 8:124447247-124447269 CAGAGGCCCTAGAAGCTAAAGGG - Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1055070136 9:72157586-72157608 CAGAGACACTAAAGGGTAGATGG - Intronic
1055451366 9:76433834-76433856 CACAGCCACTAGAAAGTAGAAGG - Intronic
1056251308 9:84751125-84751147 GAGTGGCACTGGAAGGGAGCAGG - Intronic
1056949129 9:91028151-91028173 CAGTGCCACTTGGAGGTAGTGGG + Intergenic
1058776631 9:108290582-108290604 CAATGGAACCAGAAGCTAGAGGG + Intergenic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1192751181 X:73993260-73993282 CAGTGGTGCTAGAAGATAAATGG - Intergenic
1194597692 X:95879016-95879038 AAGTGGAACTGGAAGGTAAAAGG + Intergenic
1197461889 X:126752854-126752876 CAGGAACACTGGAAGGTAGACGG + Intergenic
1197728217 X:129790510-129790532 CAGTGACACTTGAAGGTAAGTGG - Intronic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic
1199539500 X:148943555-148943577 CAAGAACACTAGAAGGTAGAAGG - Intronic
1199940802 X:152625860-152625882 CAGTGTGACTAGAAAGTAAAGGG + Intergenic