ID: 1059207926

View in Genome Browser
Species Human (GRCh38)
Location 9:112483985-112484007
Sequence CTTAAAAAACACATGCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059207926_1059207931 19 Left 1059207926 9:112483985-112484007 CCTTTGTGCATGTGTTTTTTAAG 0: 1
1: 0
2: 0
3: 39
4: 406
Right 1059207931 9:112484027-112484049 TAATAAAAGCATAATCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059207926 Original CRISPR CTTAAAAAACACATGCACAA AGG (reversed) Intronic
901361098 1:8701401-8701423 CTATAAAAACACACACACAAAGG + Intronic
901361154 1:8702169-8702191 CTTAAAACACAGAGGCACAAAGG + Intronic
901526944 1:9829309-9829331 CTTAAAAAAAAGAAACACAATGG - Intergenic
902200445 1:14829613-14829635 CCCAATAAACACATGCACACAGG - Intronic
904913978 1:33956495-33956517 CTTAAAAAGCAGACACACAATGG - Intronic
904947611 1:34210953-34210975 CTAAAAAAAAAAATCCACAAAGG - Intronic
905977193 1:42184765-42184787 CTCAAAAAACACCTGCTCAGGGG - Intronic
907819780 1:57955809-57955831 CTAGAAAAACAAATGCACCAAGG + Intronic
908527028 1:64998352-64998374 CTTAAGAAAAACTTGTACAAAGG - Intergenic
908689377 1:66760587-66760609 TTTTAAAAATAGATGCACAATGG - Intronic
908783626 1:67714099-67714121 GTTAAAACACACACACACAATGG - Intronic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909860258 1:80595757-80595779 CCTATAAAACAAATACACAATGG + Intergenic
909930417 1:81491536-81491558 CTTTAAAAACACAAACAGAAGGG + Intronic
910727525 1:90354637-90354659 CATAAACAACACATGCCAAAAGG + Intergenic
912246445 1:107965466-107965488 CCTAAACAACAAATGCTCAAAGG + Intergenic
913032362 1:114922071-114922093 CTTAAAAATCAAACTCACAAAGG - Intronic
914710185 1:150206026-150206048 CTTACAAAGCACATTCTCAAGGG - Intergenic
915153166 1:153851601-153851623 ATTAAAAAAAAAATGGACAAAGG - Intronic
915649956 1:157302511-157302533 ATTAAGAAACATAGGCACAAAGG - Intergenic
915966395 1:160312446-160312468 TTTAAAAAACAGAATCACAAAGG - Intronic
917835056 1:178934940-178934962 CCTAAAAAACACATTGAAAAAGG - Intergenic
918462236 1:184788708-184788730 CCGAAAAAACACATGGACACAGG - Intergenic
919210532 1:194477090-194477112 TTTAAAAAGCACTTGAACAATGG - Intergenic
919305925 1:195837852-195837874 CTTAAACAAAATAAGCACAATGG + Intergenic
919590499 1:199495882-199495904 CTTACAAAACAATTACACAAAGG + Intergenic
921830945 1:219726810-219726832 CTTAAAAAAAAAATGTTCAAGGG + Intronic
922020465 1:221699294-221699316 CTGACAAAAAACATGTACAAGGG - Intergenic
923020729 1:230161354-230161376 CTTAATACACACCTGCACATTGG - Intronic
923804525 1:237243652-237243674 CTTAAAAACCACAGTCAGAAAGG + Intronic
924162489 1:241247054-241247076 TTTAAAGAACATATGTACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063297225 10:4818883-4818905 CTTAAAAAAAAAAAGCACAGTGG + Intronic
1063330142 10:5150207-5150229 CTTTAAATACACTTGCAGAAAGG - Intergenic
1063398514 10:5717157-5717179 CTTCAAAAACACATACACTGGGG + Intronic
1063469352 10:6272110-6272132 CATACAACATACATGCACAATGG - Intergenic
1063597258 10:7447194-7447216 AATAAAAAACAAATGGACAAAGG - Intergenic
1064906183 10:20348233-20348255 TTTAAAAAAGCCATTCACAAGGG + Intergenic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068619197 10:59160260-59160282 GTTAAAAAATACCTGAACAAAGG - Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1069614021 10:69794949-69794971 TTTAAAAAACAGATGCAGAGAGG + Intergenic
1069646670 10:70004576-70004598 CATACAAAAAACATGCAAAATGG + Intergenic
1071321408 10:84463095-84463117 CTAAGAAACCACATGCTCAATGG - Intronic
1071892548 10:90027128-90027150 CTTAAAAAATAAATGCATGAAGG + Intergenic
1073188905 10:101635944-101635966 CTTATAAATCACAGGCAAAAAGG + Intronic
1073876504 10:107928554-107928576 CTTAAACAGCACATACACCAAGG + Intergenic
1075008897 10:118851570-118851592 CTTATAGCACACAGGCACAATGG - Intergenic
1077052393 11:573169-573191 CATAATAAACACATGCACCCAGG - Intergenic
1077652432 11:3985330-3985352 CAAAAAAAACACAAACACAAAGG - Intronic
1077710742 11:4534249-4534271 ATTAAAAAACTCACTCACAACGG + Intergenic
1078325079 11:10373837-10373859 GCAAAAAAACACACGCACAATGG - Intronic
1078636576 11:13056018-13056040 CTTAACAAATAGATGCACTAGGG - Intergenic
1081060228 11:38465306-38465328 TGTAAAAAACACATGTACAAAGG + Intergenic
1081064018 11:38517497-38517519 TTTAAAAAAAAAAGGCACAAAGG + Intergenic
1081066584 11:38548611-38548633 TTTAAAATAAACAGGCACAAAGG + Intergenic
1081257763 11:40918320-40918342 AATGCAAAACACATGCACAAAGG - Intronic
1082691900 11:56315355-56315377 CTTAAAAAGCATATGAAAAATGG - Intergenic
1083132275 11:60636052-60636074 ATTAAAAAACAGTAGCACAATGG + Intergenic
1085493375 11:76944273-76944295 CTTATAAAACAATTGCACAAAGG - Intronic
1085877654 11:80428115-80428137 CCTAACAAACACAAGCACCAAGG + Intergenic
1085877829 11:80430333-80430355 CCTAACAAACACAAGCACCAAGG - Intergenic
1086820594 11:91432200-91432222 CCTAAAAAACACAGGGAGAATGG - Intergenic
1086847536 11:91770125-91770147 CTTAAAAAGCACTTGTACATTGG - Intergenic
1087873887 11:103332456-103332478 CTTAAAAAACAAACACACACAGG + Intronic
1088184399 11:107149222-107149244 CTTTAAAAGCACTTGCACACTGG - Intergenic
1088412159 11:109546279-109546301 AATTAAAAACACAGGCACAAGGG + Intergenic
1088416941 11:109599731-109599753 CTGAAGAAACACAAGCATAAAGG - Intergenic
1089084764 11:115807495-115807517 CTAAAGAAACAGAGGCACAAGGG - Intergenic
1091526864 12:1311168-1311190 CTTTAAAAACAGATACACCAGGG + Intronic
1091880152 12:3970624-3970646 CTTAAAAAACACATACAACTGGG + Intergenic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1095357896 12:41297757-41297779 CTTGAGAATCACATGGACAAGGG - Intronic
1096979441 12:55719854-55719876 CCTAACAGACACCTGCACAAGGG - Intronic
1098022770 12:66172852-66172874 CTTACAAAACACATGTTCAAAGG - Intergenic
1098030624 12:66249782-66249804 TTTATAAAAGACATGCAGAAGGG - Exonic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1098561419 12:71877288-71877310 TTAAAAAAACAAATCCACAAAGG - Intronic
1099208843 12:79759961-79759983 CTACAAAGACACATGCACACAGG - Intergenic
1100028327 12:90155411-90155433 TTTAAAAAACACATCAACAAAGG - Intergenic
1100219027 12:92483924-92483946 CATAAAAAACACAATTACAATGG + Intergenic
1101416139 12:104509792-104509814 CTTAAATAACACAGGCAATATGG - Intronic
1101983007 12:109423909-109423931 TTTAAAAAATACACGCACAGGGG + Intronic
1103504298 12:121431129-121431151 CTCAAAAAAAAAAAGCACAAAGG - Intronic
1104606127 12:130189733-130189755 CCTTAAAAATACATGCACGAGGG - Intergenic
1105685494 13:22777126-22777148 CTTAAAAAACAACTACAAAATGG - Intergenic
1108220303 13:48227068-48227090 CATAAAAGACATATGCACCAAGG - Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109209916 13:59523406-59523428 TTTACCAAACACATGCAAAATGG - Intergenic
1110024798 13:70523003-70523025 CTTCAAAAATACATGGAAAATGG + Intergenic
1110138252 13:72096100-72096122 TTTAAAAAACACATAGACATAGG - Intergenic
1110488342 13:76072520-76072542 CTTAAAAAACTACTACACAAGGG + Intergenic
1111611127 13:90608987-90609009 ATTAGAAAACACCTGCAAAAAGG + Intergenic
1111649664 13:91073422-91073444 GTTCAGAAAGACATGCACAAAGG - Intergenic
1111986831 13:95074836-95074858 TTTAAAAACCACATGCTAAAAGG - Intronic
1112454647 13:99547960-99547982 CTTAAAACACACATACATACAGG - Intronic
1113058692 13:106297825-106297847 ATTAAAAAAGACATAAACAAGGG - Intergenic
1114488606 14:23080810-23080832 CTGAAAGAACAGATACACAATGG + Intronic
1115210175 14:30959629-30959651 CTCAAAAAACACATTCCCCATGG + Intronic
1115329551 14:32181268-32181290 CTTATAAAACAATTTCACAAAGG - Intergenic
1115409277 14:33054316-33054338 CTTAAAAATCACTTAAACAAGGG + Intronic
1115907422 14:38215211-38215233 CTGAAAAAACACTTTAACAATGG + Intergenic
1116743514 14:48787444-48787466 CATAAAAAGCAAATGCACAGAGG + Intergenic
1116849787 14:49896400-49896422 CTGAAACAAAACAAGCACAAAGG + Exonic
1117474273 14:56078128-56078150 CTGAAAAAGCACATGCCCATTGG + Intergenic
1118388053 14:65273043-65273065 CTTGAATAACACAGGGACAAGGG + Intergenic
1118434621 14:65758515-65758537 TATAAAAAATACATACACAATGG - Intergenic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1119615230 14:76094549-76094571 CATTAAAAACAAATGCTCAAAGG - Intergenic
1120540915 14:85749375-85749397 CATAGAAAACAGATACACAAGGG + Intergenic
1121093686 14:91201041-91201063 CTTACAAAGTACATTCACAAGGG + Intronic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1124173103 15:27395081-27395103 TTGTACAAACACATGCACAATGG - Intronic
1124255198 15:28135588-28135610 CTTAATAAACACATGCTGAATGG + Exonic
1124810338 15:32930690-32930712 CAAAAATAACAGATGCACAAAGG - Intronic
1124993935 15:34704255-34704277 CTTAATAGTCACATGCCCAAAGG - Intergenic
1126305538 15:47251819-47251841 ATTAATAAACACATGAACAGAGG - Intronic
1127100741 15:55562369-55562391 CTATAAAAATACATGCACACTGG + Intronic
1128209517 15:65885486-65885508 ATTAAAAAACAAATCTACAAAGG - Intronic
1129733978 15:77949476-77949498 CCCAAAAAGCACATGCAGAAAGG - Intergenic
1129841604 15:78746516-78746538 CCCAAAAAGCACATGCAGAAAGG + Intergenic
1130669389 15:85898288-85898310 CTTCAAAAACACATGTAAAAGGG + Intergenic
1132935295 16:2477270-2477292 CTTAACAAACACATGTTGAAAGG - Intronic
1133069669 16:3236621-3236643 CTTAAAAAATACAATCACACAGG - Intergenic
1134612977 16:15625174-15625196 CTTCAAAGACACAAGCACAGTGG + Intronic
1135682246 16:24467773-24467795 TTTGTAAAACACATGAACAATGG - Intergenic
1137353424 16:47734562-47734584 TTTAAAATACACACACACAAAGG - Intergenic
1137852944 16:51764367-51764389 CTTAAAACAATCATGAACAATGG - Intergenic
1139134868 16:64190180-64190202 CCTAAAAATCACATGGCCAATGG - Intergenic
1140256843 16:73344977-73344999 CTTGAAAAACAAAGGCCCAAGGG - Intergenic
1140545786 16:75807388-75807410 CTTAGAAAACATATCCACCAAGG - Intergenic
1142779260 17:2168166-2168188 TTTAAAAAAAACCTGCAAAAGGG - Intronic
1142952195 17:3492594-3492616 CTTGAAAAGCACTTGCACATTGG + Intronic
1143616595 17:8054887-8054909 CTTAAAAAAAAAACACACAAGGG - Intergenic
1144385939 17:14749245-14749267 CTTAAAAAGTATATGTACAAAGG + Intergenic
1144477786 17:15603700-15603722 TTTAAAAAACTCATGCACATGGG + Intronic
1144920509 17:18759983-18760005 TTTAAAAAACTCGTGCACATGGG - Intronic
1147710470 17:42459783-42459805 CTTGAACATCACATGCACAAAGG + Intronic
1148843612 17:50515306-50515328 TTTAAAGAGCACATGCCCAATGG - Intronic
1149168209 17:53779656-53779678 TTTAAAAAAGACATGCAGATAGG + Intergenic
1150534670 17:66023641-66023663 CTTACAAAGCAATTGCACAAAGG + Intronic
1152840699 17:82566275-82566297 TTTCACAAACACATGCACAACGG - Intronic
1153394110 18:4598481-4598503 CTTAGAAATCAATTGCACAAAGG + Intergenic
1154016443 18:10622319-10622341 CTTCAAAAACTAAAGCACAATGG - Intergenic
1154226242 18:12507038-12507060 CTTCAAAAGCATATGTACAATGG + Intronic
1155316564 18:24577774-24577796 TTTAAAACACACATACACAATGG - Intergenic
1155619624 18:27762890-27762912 CTTAATAAACACATGAGGAAGGG - Intergenic
1155933668 18:31732321-31732343 TTTAAAAAAGATAAGCACAATGG + Intergenic
1156366770 18:36436430-36436452 ATTAAAACCCCCATGCACAAAGG + Intronic
1157536874 18:48466049-48466071 CTTAAAAAACAAAAACAAAAAGG - Intergenic
1158562052 18:58522701-58522723 CTGAAAAATCCCATGCAGAAGGG + Intronic
1158743840 18:60174559-60174581 ATTTAAAAACATATGCAAAATGG + Intergenic
1159159896 18:64630542-64630564 CTTAAAACATATATGAACAAAGG + Intergenic
1159246623 18:65813594-65813616 CTTAAATAACACATAAAGAAAGG + Intronic
1162274518 19:9642140-9642162 CTTATAAAGTACATTCACAAGGG + Intronic
1163009741 19:14417632-14417654 CTTAAAAAACACATAGCCCAAGG + Intronic
1164696606 19:30249542-30249564 ACCAAAAAACACATGCAAAAAGG + Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925770446 2:7277228-7277250 CATAAAATACACATGAAGAATGG + Intergenic
926419633 2:12684113-12684135 ATTAAAATACCCATGCACACTGG + Intergenic
926622956 2:15063741-15063763 CTTACAAAACATATGCAAGAAGG + Intergenic
927171091 2:20370401-20370423 CTTGAAAAGCACTTGCACATAGG - Intergenic
928895815 2:36261785-36261807 GATAAAAAACACATGCAATATGG + Intergenic
929000204 2:37340737-37340759 ATTAAAAATGACATTCACAATGG + Intergenic
930312818 2:49763369-49763391 CGGAAAAAATACATGCAAAAAGG + Intergenic
930328958 2:49958185-49958207 CTCATTAAATACATGCACAAAGG - Intronic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
931163289 2:59717756-59717778 CTTAACAACCACAGTCACAATGG - Intergenic
931424320 2:62157195-62157217 ATTCAAAAACAGATGAACAATGG + Intergenic
931764198 2:65440141-65440163 CTTAACAAGTACATGCACATTGG - Intergenic
933758304 2:85657831-85657853 CTTACAAAGCACATTCTCAATGG + Intronic
935210080 2:100931890-100931912 TATCAAAAACACAGGCACAAAGG + Intronic
935973007 2:108549049-108549071 CTTAAAAATCTCATGCTCATGGG + Intronic
937371187 2:121298561-121298583 CTTTTAAAATATATGCACAAGGG - Intergenic
937590095 2:123602858-123602880 CTTTAAAATCACATGCAAACTGG - Intergenic
937599208 2:123709209-123709231 CTTAAACAACAAATGCATGAAGG - Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938956513 2:136303795-136303817 CTTCAAAAACAAATGCCTAAAGG - Intergenic
938986374 2:136580325-136580347 CTTAAAAATGACATGCATTATGG + Intergenic
939375485 2:141360095-141360117 CTTCAAAAACACAAGCAATAAGG + Intronic
941273440 2:163459767-163459789 TTTAAAAAATACTTGCAAAAGGG - Intergenic
941434194 2:165448185-165448207 GTTAACACACACATGCACACAGG + Intergenic
941453435 2:165687653-165687675 TTTAAATAACACAAGGACAAAGG - Exonic
941642797 2:168007471-168007493 CTTAAAAAACTGATGCTCAAGGG + Intronic
944008820 2:194945729-194945751 TTGAAAAAGAACATGCACAAAGG + Intergenic
944043457 2:195381806-195381828 ATAAAGAAACACATACACAATGG + Intergenic
944462626 2:199967166-199967188 CTTAAACAGCAATTGCACAATGG - Intronic
944565012 2:200981045-200981067 CTTCACAAACACATTTACAAGGG + Exonic
944657370 2:201889609-201889631 CTTAACAAACACAGGCACTTGGG + Intronic
945828877 2:214758916-214758938 CTGCAAAAACATATGCAAAAAGG + Intronic
946264797 2:218530040-218530062 CCTATAAAACAAATGAACAAAGG + Exonic
946268020 2:218565385-218565407 CCTATAAAACAAATGGACAAAGG + Intronic
946562710 2:220930382-220930404 TTTAAAAAAGACATGCAGATGGG - Intergenic
948175969 2:235943320-235943342 TTTTATAAACACATGCAAAAAGG + Intronic
948485435 2:238277983-238278005 ATTAACAAGCACACGCACAAGGG + Intronic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1169462753 20:5810508-5810530 CTTAAAAAATATATGTGCAATGG - Intronic
1169718862 20:8650159-8650181 CTTAAAAAAAACATCAAGAAGGG - Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170824282 20:19780349-19780371 CTTTAAAAATACAATCACAAAGG + Intergenic
1170858875 20:20084214-20084236 CTTAAAATACACACACACACAGG + Intronic
1171234683 20:23514585-23514607 CTTACAAAATACATTCTCAAGGG - Intergenic
1172748300 20:37230737-37230759 TTTAAAAAACAAGTGCTCAAAGG + Intronic
1173011329 20:39185582-39185604 CTTAATAAAAACAGGCACTAAGG - Intergenic
1173370573 20:42430912-42430934 CTTAAAACACACACTCACACAGG + Intronic
1175142581 20:56872036-56872058 ATTAAAAAACACATCCCCAGCGG + Intergenic
1175650820 20:60721075-60721097 TTTAAAAAGCATATGCACTAAGG + Intergenic
1176083885 20:63287123-63287145 CTGAAAAACCACATACACAGAGG - Intronic
1176876288 21:14132643-14132665 CTTATAAAACACTCACACAAAGG + Intronic
1177544039 21:22533732-22533754 TTTCAAAAGCACATGCACAAAGG - Intergenic
1177796278 21:25781676-25781698 ATTAAAACACACACACACAAAGG + Intergenic
1178309460 21:31517687-31517709 CTTAAACAACAGATGCAAGAAGG + Intronic
1178560515 21:33635307-33635329 CTTAAAATACATTTGCACATAGG + Intronic
1179233880 21:39528330-39528352 CTTAATAAGCCCAGGCACAATGG - Intergenic
1179607520 21:42526824-42526846 CTTAAAAACCACATTTTCAAAGG - Intronic
1180940033 22:19654716-19654738 TTTAAAAAAAAAATGCACAAAGG + Intergenic
1181380784 22:22501720-22501742 ATTTAAAAACACAGGCACAGTGG + Intronic
1181852393 22:25759174-25759196 CTTTAAAAACAAATACCCAAAGG + Intronic
1182336887 22:29589626-29589648 CTCAAAAAAAAAATGAACAAAGG + Intergenic
1184882652 22:47320482-47320504 CATAAAAAACAAATGCACCTAGG - Intergenic
1184893307 22:47392679-47392701 CCTACAGAGCACATGCACAAAGG - Intergenic
950174266 3:10861569-10861591 CTTAAAAAAATCATGGAGAAAGG + Intronic
950419534 3:12890408-12890430 ATAAAAAAACACATTCATAAAGG - Intergenic
950560314 3:13717654-13717676 TTTAAAAAACACACACACACAGG - Intergenic
950805140 3:15595511-15595533 CTTAAAAAATACATAGATAAGGG + Intronic
951051729 3:18101401-18101423 CTTAAAAAGCCCAAGCAAAAGGG - Intronic
951146741 3:19235913-19235935 TTTATCAAACAAATGCACAATGG - Intronic
951894428 3:27597671-27597693 CTTGATAAAACCATGCACAAAGG - Intergenic
952329414 3:32350336-32350358 CTTAGAACACATATGAACAATGG - Intronic
952541835 3:34374943-34374965 CTTAAACATGACAAGCACAATGG + Intergenic
952556488 3:34537433-34537455 AACAAAAAACATATGCACAATGG + Intergenic
954504726 3:51058801-51058823 CTTAAAAAAAATAGGCCCAAAGG - Intronic
954854636 3:53633448-53633470 CTTAAAAAACAAAAACAAAAAGG + Intronic
955101557 3:55854770-55854792 ATTCAGAAACACATTCACAATGG + Intronic
955116579 3:56011138-56011160 CTGGAAAATCACATACACAATGG - Intronic
955172067 3:56576356-56576378 TTTAAAAATCCCATGTACAATGG - Intronic
955401587 3:58595529-58595551 CTTAAAAAGTACATTCTCAAGGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956251948 3:67243736-67243758 TGTAACACACACATGCACAAAGG + Intergenic
957575983 3:82008989-82009011 CTGAAACAAAACAAGCACAAAGG + Intergenic
957922535 3:86764177-86764199 CTTAGTAAACTCATGCAGAAAGG + Intergenic
959750430 3:109828153-109828175 ATTAAAAAACATAAACACAAAGG + Intergenic
960168220 3:114428231-114428253 CTTAAAAACCACGTTCACAATGG + Intronic
960175932 3:114517872-114517894 CTTAAAAAATACATGTCAAATGG - Intronic
960565197 3:119125498-119125520 GTTAAAAAGTACATTCACAAGGG + Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
961371057 3:126431954-126431976 AATAAGAAACAGATGCACAAGGG - Intronic
961579022 3:127862870-127862892 CTTAAAAAGGCCAGGCACAATGG - Intergenic
962032449 3:131615600-131615622 CTCAAAAAGCACATAAACAAAGG - Intronic
964998414 3:162919010-162919032 ATTGAAAAGCACATGCACATTGG - Intergenic
965044273 3:163553804-163553826 CTTAAAAATCAAATTCCCAAAGG - Intergenic
965777214 3:172243704-172243726 TTTACAAGACACATGCACAAAGG - Intronic
966386158 3:179400878-179400900 CTTAAAAAATGCAAACACAATGG + Exonic
966728910 3:183133995-183134017 TTTAAAAGACACATGTGCAAAGG - Intronic
967306253 3:188062624-188062646 CTTAAAAAAAAAATGCAACAAGG + Intergenic
967333127 3:188312419-188312441 GTTAAAAAAGAAATGCAAAATGG - Intronic
967533897 3:190580172-190580194 CTTCAAAAAGACATTTACAATGG - Intronic
969971074 4:11048857-11048879 CTTATCACACACATACACAAGGG + Intergenic
970323411 4:14898075-14898097 CTTAACACAGACATGCACACAGG - Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972236612 4:37141698-37141720 CTTAAAAAACAAAAGCATAGTGG - Intergenic
972623099 4:40768352-40768374 CTACAAAAACACAGGCATAATGG - Intronic
972670803 4:41213142-41213164 TTTAAAAAAAACAAACACAATGG - Intronic
972939052 4:44175012-44175034 CTAAAAAAGCACCTGTACAATGG - Exonic
975032243 4:69635356-69635378 CCCAAAAGACACATGCAAAATGG + Intronic
975202685 4:71609833-71609855 CTTAAATAAAACATAAACAATGG + Intergenic
976872297 4:89810083-89810105 CAAAATAAACACATGCACTATGG + Intronic
977905457 4:102472874-102472896 CTTAAAAAAAACACACACAGGGG + Intergenic
978682806 4:111402785-111402807 TTTAATAAACACAAGTACAAGGG - Intergenic
978819025 4:112944077-112944099 ACTAAAAAACACATGTATAAAGG + Intronic
979134640 4:117094740-117094762 CTTCAAAACCCCATACACAATGG + Intergenic
981270424 4:142840740-142840762 CTTTAACACCAAATGCACAATGG + Intronic
981426361 4:144608156-144608178 CTTAGAAAACACTACCACAAAGG + Intergenic
981720647 4:147798037-147798059 CTTAAGAAACACCTGAACAGGGG - Intronic
981772420 4:148325379-148325401 GTTAAAACACACATACACAGAGG - Intronic
982605438 4:157510703-157510725 CTTAAAAATAAAATGCAGAAAGG - Intergenic
983992222 4:174134074-174134096 TTTAAAAAATACATGCAATATGG - Intergenic
984280138 4:177660463-177660485 TTTAAAAAACACACACACAAAGG - Intergenic
986032373 5:3906145-3906167 ATTAAAAATCACATGGACAAAGG - Intergenic
986196141 5:5537716-5537738 ATTAAACAACACATCCTCAAGGG - Intergenic
987520872 5:18981704-18981726 CCATAAAAACACATGCACACAGG - Intergenic
987537235 5:19205183-19205205 CATAAAAAACAAATGTCCAAAGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988341872 5:29982933-29982955 TATAAAAAACACATTCCCAAAGG - Intergenic
988441555 5:31239749-31239771 TTTAAAACTCACTTGCACAAAGG + Intronic
989182670 5:38594123-38594145 ATTTAAAAAAACATGCGCAAAGG - Intronic
990291913 5:54360539-54360561 TTTAAAAAACTCAGGCAGAAAGG - Intergenic
991433415 5:66571750-66571772 CTTAAAATACACACACACACAGG + Intergenic
991936582 5:71808002-71808024 ATTAAAATACACATGGACATTGG + Intergenic
992682816 5:79169697-79169719 CTTAAAAGACACATCCTCAAAGG + Intronic
993128475 5:83865142-83865164 CTGGCAAAGCACATGCACAATGG + Intergenic
993650671 5:90518093-90518115 TTTTAAAAACAGATGCACAGAGG + Exonic
993673481 5:90790213-90790235 CTTAAAAAACAGTTGCTAAATGG - Intronic
993804680 5:92390281-92390303 CGTAAAAAACACATTCATATTGG - Intergenic
993851335 5:93014036-93014058 CTTAAAAAATAAATGCATAAGGG - Intergenic
994923968 5:106089499-106089521 CTTGAAAACCAGATCCACAAGGG + Intergenic
995095957 5:108236209-108236231 CTTAAAAAAAACAAGCAAACAGG + Intronic
996117826 5:119637580-119637602 TTTAAAAAAAAAATGGACAAGGG - Intergenic
996801339 5:127406826-127406848 CTTAAAAAACACCTTCTGAAGGG + Intronic
996946195 5:129071660-129071682 ATTAAAACATTCATGCACAAAGG - Intergenic
997158440 5:131581933-131581955 GTTACAAAATACATTCACAAGGG - Intronic
997605925 5:135175978-135176000 CTTAAAAAACACAGACACCTGGG - Intronic
998020159 5:138763241-138763263 CTCAGAAAACACATTCACTATGG + Intronic
998091643 5:139374459-139374481 CAAAAAAAACAAATGCAAAATGG + Intronic
999487449 5:152012625-152012647 GTTAAAAAGGACATGCAAAAAGG - Intergenic
999784079 5:154875279-154875301 CTCAAAAAACAACTGCAGAATGG - Exonic
1000070706 5:157738317-157738339 CTTAAAAAATACTTTCACACTGG + Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000561651 5:162796971-162796993 CATGAAAAAATCATGCACAAAGG - Intergenic
1000794902 5:165652953-165652975 CTGAAAAAAAATATGCACTAAGG - Intergenic
1002531669 5:179850353-179850375 CTTAAAAAACACAGGTTCAAAGG - Intronic
1003677351 6:8217596-8217618 TTTAAAAAAGACTTTCACAAGGG - Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1005074467 6:21892977-21892999 CTTATAAGATACATGCTCAAAGG - Intergenic
1005167436 6:22940561-22940583 CTTAAAAAACAGAGGCTCCATGG - Intergenic
1005247718 6:23907859-23907881 CTTCAAGAACACATGGACACAGG - Intergenic
1005670167 6:28097758-28097780 CTTACAAAACACAAGTTCAAAGG - Intergenic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1006307166 6:33230064-33230086 CTTAAAAAAAAGAGGCCCAAAGG + Intergenic
1007024334 6:38554739-38554761 CTTAAAAAAAAAATCCAAAAAGG + Intronic
1007439104 6:41842387-41842409 ACAAAAAAACACATACACAATGG + Intronic
1010012519 6:71065748-71065770 CTTAAAAAATACATGGAAATTGG - Intergenic
1010163359 6:72885730-72885752 CTTAGATCACACATGCACAAGGG + Intronic
1010296169 6:74199251-74199273 ATTAAAACACACACACACAATGG - Intergenic
1010384532 6:75263966-75263988 CCTAAAAAACACATTCAGAAAGG + Intronic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1010944841 6:81961605-81961627 CCTAAATAAAACATGCGCAAAGG + Intergenic
1010978581 6:82343692-82343714 CTTAAAACTCACTTGTACAATGG + Intergenic
1011023802 6:82843829-82843851 CTGAAAAAAAACAGACACAAAGG - Intergenic
1011756637 6:90505959-90505981 CTTAAGAAATAAATGCTCAAAGG - Intergenic
1011862794 6:91781743-91781765 CACAAAAAACACATGCAGAAAGG - Intergenic
1012987478 6:105890251-105890273 CTTAAAAAACAAAAGGACAGGGG + Intergenic
1013688536 6:112613222-112613244 TTTAAAAAACAGAGGCAGAAAGG - Intergenic
1013795653 6:113885633-113885655 CATTAAACACACATGTACAATGG - Intergenic
1013811493 6:114049605-114049627 CTTAAAAAGTACTTGCACACTGG + Intergenic
1013973443 6:116047823-116047845 CTTAAAAAGCACTTGCACATTGG - Intronic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014359274 6:120455870-120455892 ATTAAAAAGCACATAAACAATGG + Intergenic
1014477111 6:121887357-121887379 CTTAAAAAACAAGTAAACAATGG + Intergenic
1015780500 6:136860715-136860737 ATTAAAAAACACAATAACAAAGG - Intronic
1015939198 6:138431735-138431757 TTTTAAAAACACAGGCACAGGGG + Exonic
1016007901 6:139108048-139108070 TTTTAAAAACACATGGACACAGG - Intergenic
1016048262 6:139502917-139502939 CTAAAACAACATATGCACAAAGG - Intergenic
1016159293 6:140857935-140857957 CTTCAAATAAACATCCACAAGGG - Intergenic
1016205566 6:141464297-141464319 CTGAAAAGATTCATGCACAATGG + Intergenic
1016244417 6:141965824-141965846 TTTAAAAAACATATCCAAAATGG + Intergenic
1016283177 6:142443023-142443045 CTTCAAAAAAACATGCACTATGG - Intronic
1016515923 6:144893021-144893043 CTTAAAAAACAAGATCACAAAGG + Intergenic
1016724302 6:147343688-147343710 GTTAAAAAATAAATTCACAAAGG + Intronic
1017292395 6:152754881-152754903 CTGAATAAAGACATTCACAATGG - Intronic
1017694341 6:156999587-156999609 CTTAAGAAACACAGGCAGCAGGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018193005 6:161327046-161327068 CTTTAAAAGCACATACAGAAAGG + Intergenic
1018367475 6:163136264-163136286 AGCAGAAAACACATGCACAAAGG - Intronic
1019002746 6:168769241-168769263 ATTAAAAAACTTAAGCACAATGG + Intergenic
1021196731 7:17682105-17682127 TTTAAATAAGAGATGCACAAGGG - Intergenic
1021254211 7:18370148-18370170 CCTATAGAATACATGCACAATGG - Intronic
1021514574 7:21470093-21470115 TTTACAATACACATGCACATGGG - Intronic
1021610737 7:22455675-22455697 CTTAACAAATACATTCACAGAGG + Intronic
1023102526 7:36733639-36733661 TTTTAGCAACACATGCACAAAGG + Intergenic
1023478375 7:40605652-40605674 CTTAAAAAACACACTAATAAAGG + Intronic
1023915255 7:44583605-44583627 CTTCAAAAAAAAATGCAGAAAGG - Intergenic
1024388506 7:48780757-48780779 TTTTAAAAACCCATGCACAATGG + Intergenic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1027112161 7:75448917-75448939 CTTAAAAAACATTGCCACAAAGG - Intronic
1027284396 7:76633458-76633480 CTTAAAAAACATTGCCACAAAGG - Intergenic
1028690867 7:93648203-93648225 TTTAAAAAAAACAAGCACTATGG + Intronic
1029308100 7:99636117-99636139 CTGAAACAAAACAAGCACAAAGG - Intergenic
1030640005 7:111993952-111993974 CTTACAAAACCCATGCTCAGTGG + Intronic
1030928378 7:115487040-115487062 CTGAATAAACACATACACATAGG - Intergenic
1031204465 7:118738167-118738189 TTTAAAAAACACCTTCATAATGG - Intergenic
1031647111 7:124240066-124240088 ATTAAAAAACACAGGCAACAAGG - Intergenic
1032643453 7:133795024-133795046 ATTTAAGAACACATGCATAATGG - Intronic
1033547847 7:142418197-142418219 TTTAGAAAACACAGGCTCAAGGG + Intergenic
1035947383 8:3980585-3980607 CATAAAAAACAAATTAACAAGGG - Intronic
1036540418 8:9702424-9702446 GGGAAAAAACACATGTACAAAGG + Intronic
1037165052 8:15817364-15817386 CTTGAAATGCACATGCTCAAAGG + Intergenic
1037302335 8:17465504-17465526 CTTAAAAATCAAATGCAACAGGG + Intergenic
1037508110 8:19553013-19553035 CATAAAAATCAAATGCACAGTGG - Intronic
1037592436 8:20324337-20324359 ATTAAAAACCAAATGCACAATGG + Intergenic
1039919468 8:41883086-41883108 CTTCAAAAACACATATCCAAAGG + Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1041502131 8:58550700-58550722 ATGAAACAACAAATGCACAATGG - Intergenic
1041794021 8:61727496-61727518 TTTAAAAATCAAATGCATAAAGG + Intergenic
1043158330 8:76814878-76814900 CTCAAAGAACAGAAGCACAAAGG - Intronic
1043202278 8:77385287-77385309 CTAAAAGAAAACAAGCACAATGG + Intergenic
1043655963 8:82665289-82665311 CTTGAAAAATACATACAGAAAGG + Intergenic
1044173839 8:89091707-89091729 CTTTAAAAACATAACCACAATGG - Intergenic
1044424773 8:92038429-92038451 ATTAAAAAACAGAAACACAAAGG + Intronic
1044575482 8:93764480-93764502 TTTCACAAATACATGCACAAAGG - Intronic
1044888709 8:96808719-96808741 CTTGAAAAACATAAGAACAAAGG - Intronic
1045423319 8:102038707-102038729 CTTCAAAAACACAAGCACAGTGG + Intronic
1046844166 8:118897112-118897134 CTTAAAAAACACATGTCTAGTGG + Intergenic
1048949384 8:139482528-139482550 CATTACAAACACATGCACATAGG - Intergenic
1049044111 8:140136149-140136171 CTTAAAAAAAAAATAGACAAGGG + Intronic
1050310848 9:4351864-4351886 CTTAAAAAAAAAATGCACACAGG + Intergenic
1050401871 9:5264723-5264745 CTTACAAAACAATTACACAAAGG - Intergenic
1051130788 9:13857989-13858011 TTTAACAAAAACTTGCACAAAGG - Intergenic
1051186909 9:14469962-14469984 TTTAAAACACACACACACAATGG - Intergenic
1051194582 9:14548791-14548813 CTTAACAAGCACTTGCACATTGG - Intergenic
1051748476 9:20317803-20317825 CTTTAAAGACTCATGCACAGTGG - Intergenic
1052331035 9:27268663-27268685 CTTAAAAAACAAACACAAAATGG - Intergenic
1052592581 9:30516903-30516925 ATTTAACAACACATTCACAAAGG - Intergenic
1054786563 9:69215901-69215923 CTTAAAAAACAAATACAATAAGG + Intronic
1055372538 9:75615825-75615847 CTAAAACCACACAGGCACAATGG + Intergenic
1055715336 9:79111187-79111209 CCAAAAAAAGTCATGCACAATGG - Intergenic
1056326436 9:85483304-85483326 CTTTAAAAAAATTTGCACAAAGG - Intergenic
1056362319 9:85871239-85871261 CTTAAAAAGCACATGTGCAATGG + Intergenic
1056593208 9:87981458-87981480 CCTCAAAAACACAGCCACAAAGG + Intergenic
1056699447 9:88890070-88890092 CATACAAAACACACACACAAAGG - Intergenic
1058398332 9:104582466-104582488 TTTTAAAAACACATGGAGAATGG + Intergenic
1058498266 9:105583736-105583758 CATAAAAAACAGATGCCCTAAGG - Intronic
1058875563 9:109241869-109241891 GTGAAACAACACAAGCACAAAGG + Intronic
1058937432 9:109781824-109781846 ATCAAAATACACATGCACAGGGG - Intronic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059819145 9:117952223-117952245 TTTAAAAAAGACATTAACAAAGG - Intergenic
1060714040 9:125904419-125904441 CTTGTAAAACCCATGCAAAATGG + Intronic
1061164040 9:128912221-128912243 CTCAAAAAACATCTGCACAAAGG - Intronic
1061379659 9:130246611-130246633 CTTAATACACACATACACAAAGG - Intergenic
1203771097 EBV:50531-50553 CCCAAAAAACGCAAGCACAAAGG - Intergenic
1185526832 X:786882-786904 TTTAAAAAGCACCTGCCCAAGGG + Intergenic
1185827068 X:3261631-3261653 CTTAAATAAAATATGCACGAAGG + Intergenic
1186347052 X:8704328-8704350 CTTCAACAACAAAAGCACAAAGG + Intronic
1187408110 X:19022655-19022677 ATTAAGAAGCACATGCACACAGG - Intronic
1188339944 X:28987058-28987080 TTTCAAAAGCACATGTACAAAGG - Intronic
1188343654 X:29037262-29037284 CTTATTAACCACATGTACAATGG - Intronic
1188878351 X:35460740-35460762 CTCACAAAACACATTCACAAGGG - Intergenic
1189550853 X:42091355-42091377 CTTCAAAAGCACATACAGAAAGG + Intergenic
1189691374 X:43620294-43620316 CTTTAAAAGCACATACAGAAAGG + Intergenic
1189915626 X:45852267-45852289 TTTAAATAACACATACACACTGG - Intergenic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1192024216 X:67431425-67431447 CTTAAAAAACAAAACCACCAGGG - Intergenic
1194933705 X:99920978-99921000 GTTAAAAGACAAATGCAGAAAGG + Intergenic
1196574684 X:117304366-117304388 CTTCAAATACAGAAGCACAAAGG + Intergenic
1197936704 X:131747146-131747168 CTTAAAAGAGACATGGACATTGG - Intergenic
1198540465 X:137633531-137633553 CCAAAAAAACAAATGCACACAGG - Intergenic
1198560117 X:137840476-137840498 ATTGAAGAACACATGTACAAGGG + Intergenic
1198926801 X:141806424-141806446 TTTTAAAAACACACACACAAAGG - Intergenic
1199035613 X:143046733-143046755 GTTAAAAAACTTCTGCACAAGGG - Intergenic
1199421265 X:147647514-147647536 CTGAAAAACCACAAGCACAATGG + Intergenic
1199531656 X:148854771-148854793 CTTGGGAAAGACATGCACAAAGG - Intronic
1201251848 Y:12066714-12066736 CTTAAATAAAATATGCAAAAAGG - Intergenic
1201499219 Y:14624021-14624043 CTCATCACACACATGCACAAAGG - Intronic
1201977164 Y:19864312-19864334 CTTTAAAAACAAATGAAAAAAGG - Intergenic