ID: 1059208880

View in Genome Browser
Species Human (GRCh38)
Location 9:112492509-112492531
Sequence CATGAAAGGCAGTAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059208880_1059208887 30 Left 1059208880 9:112492509-112492531 CCCTCTACCTACTGCCTTTCATG 0: 1
1: 0
2: 1
3: 40
4: 535
Right 1059208887 9:112492562-112492584 TACATACCTCACTCCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059208880 Original CRISPR CATGAAAGGCAGTAGGTAGA GGG (reversed) Intronic
900779146 1:4606221-4606243 CATGAAAAGCCGTGGGAAGATGG - Intergenic
906993151 1:50760677-50760699 CATTCAAAGCAGTATGTAGAGGG + Intronic
907410447 1:54279824-54279846 CAAGAAAGGCAGTAGCCAGAGGG - Intronic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
909522753 1:76588311-76588333 CATGAAAGGGAGGAGATAGGTGG - Intronic
910314824 1:85870687-85870709 CATTTAAAGCAGTATGTAGAGGG + Intronic
910540005 1:88344694-88344716 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
911006918 1:93235580-93235602 AATAAAGGGTAGTAGGTAGAGGG + Intronic
911167919 1:94741547-94741569 CAGGAAAGGCAGAAGTTAGAAGG + Intergenic
911434608 1:97840695-97840717 CATGAAAGGCAGAAGCATGAGGG + Intronic
911859637 1:102931244-102931266 CATTCAAAGCAGTGGGTAGAGGG - Intronic
911877288 1:103184097-103184119 CATGAAAGATAGAAGGTTGAAGG - Intergenic
911931371 1:103908315-103908337 CATGAAAGGCAGCTGCGAGAAGG + Intergenic
912009179 1:104938297-104938319 CATGCAAAGCAGTGTGTAGAGGG - Intergenic
912023643 1:105138973-105138995 CTTGAGAGACAGCAGGTAGATGG - Intergenic
912218612 1:107645991-107646013 GATGGAAGGCAGTAGGTCAATGG - Intronic
912503607 1:110139790-110139812 CATCAAAAGCAGTATATAGAGGG - Intergenic
913165713 1:116182660-116182682 CATGTAAGGCAGGTGGGAGAGGG - Intergenic
914850194 1:151308464-151308486 GATGGAAGGAGGTAGGTAGATGG + Intronic
914897530 1:151690228-151690250 CATGAATGGCAGAAAGTCGAAGG - Intronic
915759872 1:158300137-158300159 CATGTAAAGCAGTGTGTAGAGGG - Intergenic
915760498 1:158306920-158306942 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
915975817 1:160387751-160387773 CATGTAAAGCAGTGTGTAGAGGG - Intergenic
916843096 1:168620560-168620582 CAGCAAATGAAGTAGGTAGAAGG + Intergenic
917842262 1:178990748-178990770 CATTCAAAGCAGTATGTAGAGGG - Intergenic
918418792 1:184340499-184340521 CATTCAAAGCAGTATGTAGAGGG - Intergenic
919461386 1:197881834-197881856 CATTTAAAGCAGTATGTAGAAGG - Intergenic
919927066 1:202197205-202197227 CATGAAAGGTATTGGCTAGAAGG - Intronic
920235184 1:204498267-204498289 AATATAAGGCAGTGGGTAGAGGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
921004405 1:211078608-211078630 CATTTAAAGCAGTATGTAGAGGG + Intronic
921368432 1:214397384-214397406 CATGAAATGCAGGGGGGAGATGG + Intronic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
923444184 1:234052789-234052811 CATGTAAAGCAGTGTGTAGAGGG - Intronic
924069290 1:240259388-240259410 CATGAAAGGCAGTAGTTGAAGGG + Intronic
924100555 1:240598855-240598877 TATGAAAGTCAGTAGCCAGATGG - Intronic
924448482 1:244156303-244156325 AACAAAAGGCAGTGGGTAGAGGG - Intergenic
924582191 1:245332163-245332185 CAGGAAATGCAGTAAGCAGATGG + Intronic
924863996 1:247958093-247958115 CATTCAAAGCAGTATGTAGAGGG - Intronic
924873140 1:248070465-248070487 CATTCAAAGCAGTATGTAGAGGG + Intronic
924892654 1:248300025-248300047 CATTCAAAGCAGTATGTAGAGGG + Intergenic
924928149 1:248703507-248703529 TATGAAAGGCTGTTGGAAGATGG - Intergenic
1062915754 10:1240378-1240400 CAAGACCGGCAGAAGGTAGATGG - Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064126597 10:12666904-12666926 CAGGTAAGGCAGTAGGGAGCAGG + Intronic
1064343184 10:14505939-14505961 GAGGAAAGGCAGTTGGTAGGTGG + Intergenic
1064761951 10:18630244-18630266 CATTCAAAGCAGTATGTAGAGGG + Intronic
1064916321 10:20462828-20462850 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1064959928 10:20952562-20952584 CTGGAAAGGCAACAGGTAGAGGG + Intronic
1065075724 10:22077474-22077496 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1066158782 10:32706309-32706331 CATTTAAAGCAGTATGTAGAGGG + Intronic
1066163260 10:32757592-32757614 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1067193291 10:44090910-44090932 CATGAAAGGCGGTTCCTAGATGG + Intergenic
1069141893 10:64837574-64837596 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1071519646 10:86321524-86321546 CTTGCAAGGCAGAAGGTTGATGG + Intronic
1072005566 10:91243268-91243290 CATGACAGCCACTAGGTAAAGGG + Intronic
1072383061 10:94895323-94895345 CATTCAAGGCAGTATGTAGACGG + Intergenic
1072485866 10:95854584-95854606 CATTCAAAGCAGTATGTAGAGGG - Intronic
1073229147 10:101952613-101952635 CATCAATGGCAGTAGTAAGAAGG + Intronic
1073666942 10:105544154-105544176 TTTGAAAGGCAGAAGGTAGGAGG - Intergenic
1073979154 10:109134395-109134417 CATTAAAAGCAGTGGGTAGAGGG + Intergenic
1074415640 10:113264644-113264666 CATGAAGGGGAGTTGGGAGAAGG + Intergenic
1074692086 10:116015496-116015518 CATCAAAGCCAGTATGTAAATGG + Intergenic
1076125825 10:127972858-127972880 CATTAAAGGCCGGTGGTAGAGGG - Intronic
1076281263 10:129248514-129248536 AATGAAAGTCAGTAGATAAATGG - Intergenic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1077818736 11:5714572-5714594 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1078612265 11:12830949-12830971 GATGAAGGGCAGGAGGAAGAAGG - Intronic
1078889651 11:15542934-15542956 CAAGGAAGTCAGTAGGTAGCTGG + Intergenic
1079026496 11:16952207-16952229 GATGAATGGATGTAGGTAGAAGG + Intronic
1079083580 11:17430197-17430219 AATGAAAGCCTGAAGGTAGAAGG - Intronic
1079281411 11:19090185-19090207 CATTAAAAGTAGGAGGTAGAAGG + Intergenic
1079909368 11:26290561-26290583 CATTTAAAGCAGTTGGTAGAGGG - Intergenic
1080138136 11:28882553-28882575 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1080258303 11:30318274-30318296 CATGACAGCCAGAAGGTAGTTGG - Intergenic
1080346581 11:31332530-31332552 CATTTAAAGCAGTGGGTAGAGGG - Intronic
1080348663 11:31356426-31356448 CATTCAAAGCAGTATGTAGAGGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1080918285 11:36682606-36682628 GAAGAAAGGCATTAGGTGGAAGG - Intergenic
1081083585 11:38772772-38772794 CATGTAAGGCAGTAGTAAGAGGG + Intergenic
1082135539 11:48545056-48545078 CATTCAAAGCAGTAGGTAGAGGG - Intergenic
1082314937 11:50706439-50706461 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1083373396 11:62200254-62200276 CATGAAAAGCAGTATGTATGTGG + Intergenic
1084286382 11:68133908-68133930 CATGACAGGAAGTGGGTAGGGGG + Intergenic
1084893730 11:72250462-72250484 CATGAAAGGAAGGTGGTAGAGGG - Intergenic
1085324000 11:75592840-75592862 CAGGAAAGGCAGGAAGGAGAGGG - Intronic
1085536279 11:77221383-77221405 CATGTAAAGCAGTGTGTAGAGGG - Intronic
1086044769 11:82519925-82519947 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1086580818 11:88396259-88396281 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1086612602 11:88775591-88775613 CATTTAATGCAGTATGTAGAGGG - Intronic
1087325982 11:96724316-96724338 CATCTAAAGCAGTATGTAGAGGG - Intergenic
1087341294 11:96910907-96910929 CATTTAAAGCAGTAGGTAGAGGG + Intergenic
1087547631 11:99604939-99604961 CATTCAAAGCAGTATGTAGAGGG + Intronic
1087719118 11:101641875-101641897 CATTTAAAGCAGTATGTAGATGG + Intronic
1088318382 11:108530455-108530477 CAGGGAAGGCAATAGGAAGATGG + Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088969580 11:114761178-114761200 CAGGAAAGGCAGTAGGTGTCAGG - Intergenic
1090576459 11:128110077-128110099 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1090706464 11:129342071-129342093 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091441061 12:512027-512049 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091441177 12:512496-512518 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091576061 12:1736764-1736786 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091914395 12:4258995-4259017 CATGGAAGCCAGAAGGTAGTGGG - Intergenic
1092325965 12:7531478-7531500 CATTTAAGGCAGTGCGTAGAGGG + Intergenic
1092664383 12:10779226-10779248 CATGACAGTCAGGAGGCAGAGGG + Intergenic
1092835858 12:12487702-12487724 CCTGATAGTCAGTAGGTAGTTGG - Intronic
1093124462 12:15312036-15312058 CAGGAAAGGCAGTACTAAGAGGG - Intronic
1093344736 12:18026754-18026776 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1094312079 12:29095153-29095175 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1094476034 12:30841370-30841392 CATGAAAGGGAAAAGGTTGAGGG - Intergenic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1097139746 12:56890891-56890913 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1097965484 12:65575140-65575162 CATGTAAGACAGTAGGGAGAAGG + Intergenic
1098530522 12:71536657-71536679 CAAGGCAGGCAGTAGATAGAAGG + Intronic
1098533661 12:71570357-71570379 CCTGAAAATCATTAGGTAGAAGG + Intronic
1098699705 12:73608670-73608692 CATTGAAAGCAGTATGTAGAGGG + Intergenic
1099019590 12:77386920-77386942 CATGAGAAGCAGTTGGAAGAAGG + Intergenic
1099029752 12:77511603-77511625 CATGATGGTGAGTAGGTAGATGG + Intergenic
1099839343 12:87946168-87946190 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1099841500 12:87972915-87972937 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1099918949 12:88933125-88933147 CATGAAAGGAGGCATGTAGAAGG - Intergenic
1100653221 12:96613359-96613381 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1101243182 12:102858813-102858835 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1101362630 12:104042260-104042282 CATGCAAGGCAGGAGGAAGGGGG - Intronic
1101401486 12:104391716-104391738 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102603886 12:114053968-114053990 CATGAAAGATAGTAGGAAGAAGG - Intergenic
1102713746 12:114952230-114952252 CAAGAAAGGCAGAGTGTAGATGG - Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1105073010 12:133247913-133247935 CATTCAAAGCAGTGGGTAGAGGG + Intergenic
1105648680 13:22349046-22349068 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1107487078 13:40838709-40838731 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1108230650 13:48336833-48336855 CATGTAAAGCAGTGTGTAGAGGG - Intronic
1108304899 13:49121335-49121357 CATTTAAAGCAGTATGTAGAGGG + Intronic
1109659401 13:65438371-65438393 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1110261617 13:73491441-73491463 CATGAAAGTCAGAAGGGTGAGGG + Intergenic
1110666864 13:78127216-78127238 CTTTTAAGGCTGTAGGTAGAGGG + Intergenic
1111004647 13:82231987-82232009 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1111779175 13:92699579-92699601 CATTTAAAGCAGTATGTAGAGGG - Intronic
1112411681 13:99169822-99169844 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113703448 13:112407207-112407229 CATTTAAAGCAGTATGTAGAGGG + Intronic
1115007817 14:28508278-28508300 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1115278712 14:31637240-31637262 CATTCAAAGCAGTATGTAGAGGG - Intronic
1115318705 14:32054716-32054738 CATGGATGGCAGCAGGCAGAGGG - Intergenic
1115390942 14:32854312-32854334 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1115418830 14:33168753-33168775 CGTGAATGGCAGAAGGAAGAGGG - Intronic
1115705588 14:35994749-35994771 CTTCAAAGGCAGTGGGCAGAAGG - Intergenic
1115722386 14:36177289-36177311 CTGGAAAGGCAGTGGGCAGATGG - Intergenic
1115804056 14:37031088-37031110 CTTGAAAGGCTGTAGGTTGTTGG - Intronic
1115934031 14:38531362-38531384 CATGAAAAGGAGTAGAGAGATGG + Intergenic
1116032225 14:39587423-39587445 CATTCAAAGCAGTATGTAGAAGG - Intergenic
1116284659 14:42956382-42956404 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1116768431 14:49099558-49099580 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1117431963 14:55675883-55675905 AATGAAAGACAGAAGGTAGCTGG + Exonic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1117802975 14:59464354-59464376 CAGGAAGGGCAGCAGGTAGCAGG + Exonic
1117808160 14:59516157-59516179 CATTCAAAGCAGTATGTAGAGGG + Intronic
1117811756 14:59554455-59554477 CATTTAAAGCAGTATGTAGAGGG + Intronic
1117964908 14:61197051-61197073 CATGAAAGTCAGAAGTGAGACGG - Intronic
1119825394 14:77653612-77653634 CAAGAAAGGAAGTAAGGAGAGGG + Intergenic
1120404704 14:84080182-84080204 CATGCAAGGAAGTAGGATGATGG - Intergenic
1121103513 14:91265360-91265382 CATGAAAGGCCTCAGGGAGAGGG - Intergenic
1121151904 14:91643361-91643383 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1122194099 14:100072132-100072154 CTTGAAAGGGAGTAAGCAGACGG + Intronic
1122382366 14:101317418-101317440 TATGAAAGACCGTAGGGAGATGG + Intergenic
1124842686 15:33258237-33258259 CATGGAGGGCAGGAGGTTGAAGG - Intergenic
1126358197 15:47818295-47818317 CATGAAAGGAAGTCGGTGAAAGG + Intergenic
1127189282 15:56512676-56512698 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1127355622 15:58196383-58196405 CATTAAAAGCAGTGTGTAGAGGG + Intronic
1127749490 15:62019440-62019462 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1128487025 15:68102826-68102848 AATGGAAGGCAGCAGGCAGATGG - Intronic
1128895585 15:71370433-71370455 CATTTAAAGCAGTATGTAGAGGG - Intronic
1130432624 15:83863604-83863626 CATTCAAAGCAGTATGTAGAGGG + Intronic
1130452887 15:84075069-84075091 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1130689819 15:86072251-86072273 CAGCAAAGGCAGTACATAGAGGG + Intergenic
1131866392 15:96715828-96715850 CATTAAAGGCAGTAAGTGGTAGG + Intergenic
1132242980 15:100275293-100275315 CATGAAAGGCAGGGGGTGGGGGG + Intronic
1132277004 15:100576014-100576036 CATTTAAAGCAGTACGTAGAGGG + Intronic
1134987766 16:18669709-18669731 CATTAAAAGCAGCATGTAGAGGG - Intergenic
1135678905 16:24440362-24440384 CATGAAATGCAGTAGCAAGAAGG + Intergenic
1135865286 16:26095606-26095628 CATTTAAAGCAGTATGTAGAGGG + Intronic
1137228508 16:46538335-46538357 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1138357426 16:56394199-56394221 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1138786306 16:59850743-59850765 CATGAAAGGCCGTGCATAGAAGG - Intergenic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1139384411 16:66555792-66555814 GATGAAAGGCAGTAGTTGTAAGG + Intronic
1140178977 16:72695174-72695196 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1140437035 16:74955687-74955709 CAGGAAAGGCAGTCTGCAGAAGG - Intronic
1140632615 16:76872273-76872295 CATGAAAGGCAGAACATAGAGGG - Intergenic
1140885953 16:79243040-79243062 CATGTAAAGCAGTATGCAGAGGG + Intergenic
1141047598 16:80729941-80729963 CATTCAAAGCAGTGGGTAGAGGG + Intronic
1141234896 16:82206917-82206939 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1142028742 16:87828140-87828162 CCTGAGGGGCAGTAGATAGAGGG + Intergenic
1145377198 17:22361907-22361929 TATGTAAGTCAGTAGTTAGAAGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1147437775 17:40428216-40428238 CATTAGAGGCAGTAGGGAGGAGG + Intergenic
1147599979 17:41739461-41739483 CATGGAAGACAGCAGGCAGAGGG - Intergenic
1149191668 17:54070563-54070585 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1149225247 17:54463046-54463068 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1149235954 17:54591186-54591208 CATTTAAAGCAGTATGTAGATGG - Intergenic
1149455642 17:56785935-56785957 CAGGAAAGGCTCTAGGAAGAGGG - Intergenic
1149708629 17:58718344-58718366 CATGAAAAGCAGTAAGAAAAAGG - Intronic
1150067856 17:62126349-62126371 CAGGAAGAGCAGGAGGTAGAAGG - Intergenic
1151594051 17:75066052-75066074 AATGAAAGGGAGGAGGGAGAAGG - Intergenic
1152017013 17:77757341-77757363 CATCAAAGGCAGGAGGCAGCTGG + Intergenic
1152022612 17:77788548-77788570 CATGTCAGGCAGAAGGGAGAGGG + Intergenic
1153173435 18:2343438-2343460 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1153420109 18:4895559-4895581 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1153593778 18:6702780-6702802 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1154444721 18:14426087-14426109 CATGTAAAGCAGTGTGTAGAGGG - Intergenic
1155074960 18:22346584-22346606 CATGGAAGGAAGTATCTAGAAGG + Intergenic
1155178996 18:23327038-23327060 CATTTAAAGCAGTATGTAGAGGG + Intronic
1155437206 18:25826087-25826109 AATGACAGGCAGTGGGTGGAGGG - Intergenic
1156353278 18:36319976-36319998 CATTTAAAGCAGTATGTAGAGGG + Intronic
1157074010 18:44444992-44445014 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1158054048 18:53258363-53258385 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1158168744 18:54572662-54572684 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1158176880 18:54667340-54667362 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1159337591 18:67090019-67090041 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1161431249 19:4233577-4233599 CATGGAGGGCTGTAGGCAGAGGG - Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162454541 19:10775493-10775515 ATTGAAATGGAGTAGGTAGAAGG + Intronic
1163914288 19:20226341-20226363 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1163996340 19:21051388-21051410 ACTGAAAGCCAGTAGGTAAAAGG - Intronic
1164110377 19:22151358-22151380 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
1164110990 19:22158675-22158697 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
1164395068 19:27855653-27855675 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1165026988 19:32969459-32969481 CATGAATGGCAGCAGGAGGAAGG - Intronic
1166022087 19:40041057-40041079 CATTCAAAGCAGTATGTAGAGGG - Intronic
1167879973 19:52448979-52449001 CATGAAAAGAAGTAGGTTAATGG - Intronic
1168561361 19:57386497-57386519 TATGAAAGCCAGTTGGTAAATGG - Intronic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926219593 2:10925843-10925865 CATGGAAGGCTTTAGGCAGAGGG - Intergenic
926389279 2:12370932-12370954 CATAGAAAACAGTAGGTAGAGGG + Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
928463631 2:31499279-31499301 CATGCAAAGCAGTGTGTAGAGGG + Intergenic
928529066 2:32172090-32172112 CATGAAACACAGTAACTAGAAGG - Intronic
929113160 2:38422244-38422266 CAAGAAAGGCACAAGATAGAAGG + Intergenic
929460205 2:42097730-42097752 CATGAAAGGCATGAGGAAGGAGG - Intergenic
930216717 2:48705041-48705063 CATTTAAAGCAGTATGTAGAGGG - Intronic
930268724 2:49230861-49230883 CATTTAAAGCAGTATGTAGAGGG - Intergenic
930437314 2:51361842-51361864 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
931887192 2:66630237-66630259 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
932669466 2:73724374-73724396 CATTCAAAGCAGTATGTAGAGGG + Intergenic
933023359 2:77222196-77222218 CATTCAAAGCAGTATGTAGAGGG + Intronic
933386155 2:81613124-81613146 CATAAAAAGCAGTTGGTAGGAGG - Intergenic
934770898 2:96907158-96907180 GATGAAAGGCAGTGGGCAGGCGG - Intronic
936642957 2:114336070-114336092 CATTGAAAGCAGTATGTAGAGGG + Intergenic
936662328 2:114556122-114556144 CAAGAAGGGCAGCAGGGAGATGG + Intronic
937633164 2:124125903-124125925 CATTTAAAGCAGTATGTAGAGGG + Intronic
938139270 2:128783040-128783062 CATGACAGGCAGTGTGGAGAGGG - Intergenic
938617403 2:133013452-133013474 CATGAATGGCAGCAGGCAAAGGG + Intronic
938659155 2:133468162-133468184 CATTCAAAGCAGTATGTAGAGGG - Intronic
939938916 2:148325987-148326009 CATTCAAAGCAGTATGTAGAGGG - Intronic
940417198 2:153436977-153436999 CATTCAAAGCAGTATGTAGAGGG - Intergenic
940593724 2:155764269-155764291 CATTTAAAGCAGTATGTAGAGGG - Intergenic
940620880 2:156111846-156111868 CAGGGAAGGCTGTAGGTAGGAGG - Intergenic
940644185 2:156373401-156373423 CATTTAAAGCAGTATGTAGAGGG - Intergenic
940824782 2:158398617-158398639 CATTTAAAGCAGTGGGTAGAGGG + Intronic
940828122 2:158436466-158436488 CATTAAAAGCAGTGTGTAGAGGG + Intronic
941516946 2:166491891-166491913 AGTCTAAGGCAGTAGGTAGATGG + Intronic
941849759 2:170168017-170168039 CGTGAAAATCAGTAGGTAGTTGG + Intergenic
942392145 2:175506452-175506474 CATTTAAAGCAGTATGTAGAGGG + Intergenic
942669158 2:178355076-178355098 CATTTAAAGCAGTATGTAGAGGG + Intronic
942873850 2:180768068-180768090 CATTCAAAGCAGTATGTAGAGGG + Intergenic
943259277 2:185637989-185638011 TATAAAATGCAGCAGGTAGAAGG - Intergenic
943857519 2:192816404-192816426 CATGGTGGGCAGTAGGGAGAGGG + Intergenic
943942060 2:194011022-194011044 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
944002247 2:194853700-194853722 CATTTAAAGCAGTATGTAGAGGG - Intergenic
944507859 2:200432182-200432204 CAAGAAAGGAAGTAGATGGAAGG + Intronic
944542137 2:200764282-200764304 CATGAAAGGCAGTGGGATGTAGG - Intergenic
945148374 2:206762597-206762619 TACGAAAGGCAATAGCTAGAGGG - Intronic
945371805 2:209027788-209027810 CTTTAAAGGCAGTAGGTAAGTGG + Intergenic
946139502 2:217677274-217677296 CATTCAAAGCAGTATGTAGAGGG - Intronic
947483845 2:230528417-230528439 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1169444923 20:5663609-5663631 TATGAAAGGCAGCCAGTAGAAGG - Intergenic
1169570264 20:6898533-6898555 CATGAAAAGAAGGAGGGAGAGGG + Intergenic
1171076521 20:22132163-22132185 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1171140553 20:22737624-22737646 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1171404798 20:24903447-24903469 CATTCAATGCAGTGGGTAGAGGG + Intergenic
1171912200 20:30973604-30973626 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1172956147 20:38760772-38760794 ATTGAAAGGCAGTGGGTAGATGG + Intronic
1172956949 20:38767536-38767558 CATGAAAGCCAGAATGGAGAAGG + Exonic
1173494989 20:43512170-43512192 CAGGAAAGGAAGCAGGGAGATGG + Intronic
1175384915 20:58588344-58588366 GATGGATGACAGTAGGTAGATGG - Intergenic
1175658073 20:60789377-60789399 GGTGAAAGGCAGAAGGTAGCTGG + Intergenic
1176451266 21:6863778-6863800 CATGTAAAGCAGTATGTAGAGGG + Intergenic
1176777074 21:13147270-13147292 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1176829435 21:13728829-13728851 CATGTAAAGCAGTATGTAGAGGG + Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178585939 21:33870868-33870890 CTTGAGAGACAGCAGGTAGATGG + Intronic
1179301216 21:40112406-40112428 CATTTAAGACAGTATGTAGAAGG + Intronic
1181421562 22:22802906-22802928 TATGAAGGGCAGGAGGTAGAAGG - Intronic
1181425445 22:22834681-22834703 AATGAAGGGCAGGAGGTAGAAGG - Intronic
1181429689 22:22871552-22871574 AATGAAGGGCAGTAGGTAGAAGG - Intronic
1181901753 22:26161674-26161696 CATGGAAGGCTGTAGGTTAAGGG + Intergenic
1182090410 22:27590921-27590943 CATGAAAGTCTATAGGTAGAGGG + Intergenic
1182831357 22:33307162-33307184 CATGACAAGCAGCAGGTAAAGGG - Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
950327628 3:12126954-12126976 TATGAAAGGCACTTGGTAGGGGG - Intronic
950979974 3:17292121-17292143 GATAAAAGGGAGTAGGAAGAAGG + Intronic
951985992 3:28621575-28621597 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
951995473 3:28722911-28722933 GATGAAAGGGAGGAGGTAAAAGG + Intergenic
952133278 3:30388836-30388858 CATTTAAAGCAGTATGTAGAGGG - Intergenic
953036570 3:39216834-39216856 GACGAAAGGCAGTAGCTGGAGGG - Intergenic
953503573 3:43461628-43461650 CATGAATGGCAGCAGGCAAAGGG - Intronic
953782952 3:45887615-45887637 CAGGAAAGGGAGTAAGGAGATGG - Intronic
955445770 3:59007990-59008012 CATGAAAGGCATTAGAGAAAGGG + Intronic
956472043 3:69577504-69577526 CATTTAAAGCAGTGGGTAGACGG - Intergenic
957815562 3:85292779-85292801 CATTAAAAGCAGTGTGTAGAGGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958409986 3:93804539-93804561 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
958846046 3:99265181-99265203 CATGTAAAGCAGTAATTAGAGGG + Intergenic
959218273 3:103481307-103481329 CATTCAAAGCAGTATGTAGAGGG - Intergenic
959604647 3:108228902-108228924 CATGAAAGGCACTATGAAGTTGG + Intergenic
959778881 3:110204172-110204194 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
960339573 3:116458166-116458188 CATTCAAAGCAGTGGGTAGAGGG + Intronic
961067651 3:123890045-123890067 CATGAATGGCAGCAGGCAGAGGG + Intergenic
962045576 3:131756545-131756567 AATGAATGGCAGAAGATAGATGG + Intronic
962125239 3:132610216-132610238 CATTCAAAGCAGTATGTAGAGGG + Intronic
962617364 3:137140353-137140375 CATTCAAAGCAGTATGTAGAGGG + Intergenic
962691130 3:137899582-137899604 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
962699487 3:137982817-137982839 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
963235804 3:142954438-142954460 CATAAAATGCAGCAGGCAGAAGG - Intronic
963527957 3:146437925-146437947 CATTTAATGCAGTGGGTAGAGGG - Intronic
964214615 3:154265563-154265585 CATTTAAAGCAGTGGGTAGAAGG + Intergenic
964759304 3:160118885-160118907 CATTTAAAGCAGTATGTAGACGG + Intergenic
965257459 3:166433044-166433066 CATGAAAGACAGTAGCAATATGG - Intergenic
967419294 3:189256164-189256186 CAGCTAAGGCAGTAGGTAGAAGG - Intronic
967949196 3:194827768-194827790 AATGTAAGGCAGCAGGTAGAAGG - Intergenic
969345735 4:6568694-6568716 CATGTAAGGCAGGAGGAAGGGGG - Intergenic
969813436 4:9667986-9668008 CATCAAAAGCAGTAGGCACAGGG + Intergenic
970120886 4:12751121-12751143 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
970837102 4:20422601-20422623 AATGAGAGGCAGTGGGCAGAAGG + Intronic
971438403 4:26653019-26653041 CATTCAAAGCAGTATGTAGAAGG - Intronic
972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG + Intergenic
972946915 4:44267384-44267406 CATTCAAGGCAGTGTGTAGAGGG + Intronic
973704441 4:53567485-53567507 CATGCAAAGCAGTGTGTAGAGGG + Intronic
974111852 4:57535006-57535028 CATTCAAAGCAGTATGTAGAGGG - Intergenic
974840855 4:67297994-67298016 CATGCAAAGCAGTGTGTAGAGGG - Intergenic
975753281 4:77546891-77546913 CATGTAAAGCAGTATGTAGAGGG - Intronic
975803323 4:78086265-78086287 CATTAAAAGCAGTGTGTAGAGGG + Intronic
975806251 4:78115981-78116003 CATTAAAAGCAGTGTGTAGACGG - Intronic
975821374 4:78274466-78274488 CATGTAAAGCAGTGTGTAGAGGG - Intronic
976487495 4:85625223-85625245 CATTCAAAGCAGTATGTAGAGGG - Intronic
977496451 4:97780921-97780943 CATTTAAAGCAGTGGGTAGAGGG + Intronic
977497650 4:97798334-97798356 CATTTAAGGCAGTGGGTAGAGGG - Intronic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
978904441 4:113989001-113989023 CATTCAAAGCAGTATGTAGAGGG + Intergenic
979062804 4:116086385-116086407 CAAGAAATAAAGTAGGTAGAGGG + Intergenic
979163680 4:117497370-117497392 CATCAAATGAGGTAGGTAGAGGG - Intergenic
979512513 4:121570285-121570307 CATTTAAAGCAGTATGTAGAGGG + Intergenic
979747896 4:124240218-124240240 CATTTAAAGCAGTATGTAGAGGG + Intergenic
979757208 4:124356118-124356140 CATCAAAGGCAGTACTAAGAGGG + Intergenic
981151175 4:141380751-141380773 CATGCAAAGCAGTGTGTAGAGGG + Intergenic
981170208 4:141614864-141614886 CATGATAGGCAGTAAGAATATGG - Intergenic
981272781 4:142864073-142864095 CATAAGAGACAGAAGGTAGAAGG - Intergenic
982145286 4:152381844-152381866 CATGAAAGGCAAAAAGTTGATGG - Intronic
982687007 4:158502568-158502590 CTTGAAAGGCAGCATATAGATGG - Intronic
982785416 4:159531191-159531213 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
983262222 4:165469759-165469781 TATGACAGGCAGTAGGCTGAGGG + Intronic
983460308 4:168018576-168018598 CATGAAAGGTACTAAGTAGATGG - Intergenic
983658759 4:170110676-170110698 CATGAAAAGGAGGTGGTAGAGGG - Intergenic
984259864 4:177431976-177431998 CATGAAAGGAATGAGGTAGCTGG + Intronic
984880773 4:184408346-184408368 CATTAAAGAAAGTAGGCAGAGGG - Intronic
985139785 4:186828205-186828227 TATGCAAGGCAGTATGTATAGGG + Intergenic
985140716 4:186837856-186837878 CATGAAAGGCACTAGGCTAAAGG + Intergenic
985240610 4:187927661-187927683 CTTGAAAGGCAGCAGATAGTTGG + Intergenic
986581955 5:9274821-9274843 CATTTAAAGCAGTGGGTAGAGGG + Intronic
986597106 5:9435238-9435260 TATAAAAGGCAGTATGTATAAGG + Intronic
986765185 5:10919177-10919199 CAGGAATGGCAGCAGGTAAAGGG + Intergenic
987172624 5:15274252-15274274 CATTCAAAGCAGTATGTAGAGGG + Intergenic
987444919 5:18005925-18005947 CATTTAAAGCAGTATGTAGAAGG - Intergenic
988698537 5:33649009-33649031 AATGAAAGGCTGAAGGTAAAGGG - Intronic
989203585 5:38789836-38789858 CAAGTAAGGAAGTAGGTAGTTGG + Intergenic
989249551 5:39294048-39294070 CAGAAAAGGCAGTAGTAAGAGGG + Intronic
989490342 5:42044904-42044926 ATTGAAAAGCAGTAGGGAGAGGG - Intergenic
989562277 5:42865787-42865809 CATTTAAAGCAGTATGTAGAGGG + Intronic
989607959 5:43263772-43263794 CATGTAAAGCAGTGTGTAGAGGG - Intronic
989614476 5:43326040-43326062 CATGTAAAGCAGTGTGTAGAGGG - Intergenic
989824756 5:45839627-45839649 CCTGAGAACCAGTAGGTAGAGGG + Intergenic
990482428 5:56224327-56224349 CATTTAAGGCAGTGTGTAGAGGG + Intronic
990657127 5:57969766-57969788 CATTAAAAGCAGTGTGTAGAAGG - Intergenic
991421514 5:66447423-66447445 CATTCAAAGCAGTATGTAGAGGG - Intergenic
991571812 5:68062667-68062689 CATTTAAAGCAGTATGTAGAGGG + Intergenic
991576120 5:68105215-68105237 CATTTAAAGCAGTATGTAGACGG + Intergenic
992290389 5:75273483-75273505 CATGCAAATCTGTAGGTAGATGG - Intergenic
992700680 5:79338879-79338901 CATTTAAAGCAGTATGTAGAGGG - Intergenic
993142641 5:84053298-84053320 CATTCAAAGCAGTGGGTAGAGGG + Intronic
993528020 5:88990572-88990594 CATTTAAAGCAGTATGTAGAGGG - Intergenic
993798486 5:92300120-92300142 CATTGAAAGCAGTATGTAGAGGG - Intergenic
994280820 5:97900305-97900327 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
994288109 5:97994295-97994317 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994290676 5:98025585-98025607 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994473899 5:100242921-100242943 CATGAGGGGCAGAAGCTAGAAGG + Intergenic
994732972 5:103516280-103516302 CATAGAAGGCAGTATGGAGAGGG + Intergenic
994973551 5:106774132-106774154 CATTCAAAGCAGTATGTAGAGGG - Intergenic
995585975 5:113648788-113648810 CATTTAAAGCAGTATGTAGAGGG + Intergenic
997042084 5:130268678-130268700 CATCACAGGAAGTGGGTAGAAGG - Intergenic
997397272 5:133572854-133572876 CATGAAAGGCAGAAGAGAAAAGG + Intronic
997861408 5:137420948-137420970 CATTCAAAGCAGTATGTAGAGGG - Intronic
997948279 5:138221522-138221544 CATGAAAGTTAGAAGGGAGAGGG + Intergenic
997956340 5:138281400-138281422 CATGAAAGTTAGAAGGGAGAGGG + Intergenic
998060945 5:139118393-139118415 CATGTTAGGAAGTAGGCAGAGGG + Intronic
998310860 5:141129090-141129112 AATGAAATGCATTAGGCAGAAGG + Intronic
998367116 5:141638677-141638699 CATGATAGCAAGTAGGTAAAAGG + Intronic
999142124 5:149369329-149369351 CATGCGAGGCTGTAGGAAGAGGG + Exonic
999879451 5:155845283-155845305 CATGGAAGGCAGCAGGTACCTGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001898338 5:175400624-175400646 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1002973520 6:2049868-2049890 CATGTAAAGCAGTGTGTAGAGGG + Intronic
1002975126 6:2067254-2067276 CATGCAAAGCAGTATGTAGAGGG + Intronic
1003434137 6:6069871-6069893 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1005073523 6:21885057-21885079 CTTGATAGGCAGTTGGTAGTGGG + Intergenic
1005075677 6:21904070-21904092 CACCAAAGGCAGTGGGAAGATGG - Intergenic
1005100659 6:22169522-22169544 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1005610048 6:27514974-27514996 CAGGAAAGGCAGTCTGCAGAAGG - Intergenic
1006029051 6:31165812-31165834 CATGAAGAGGAGTAGGGAGAGGG - Intronic
1008236806 6:49060625-49060647 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1008281529 6:49601508-49601530 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1008307583 6:49923111-49923133 CAAGAAAGGCAGTATCAAGAGGG + Intergenic
1008787702 6:55189401-55189423 CATGAGAGGCAGTCTGAAGATGG + Intronic
1009299896 6:62003993-62004015 CATTTAAAGCAGTATGTAGAGGG + Intronic
1009445065 6:63732979-63733001 CAGGAAAGGCATTATGAAGAAGG + Intronic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009457680 6:63876123-63876145 CATTTAAAGCAGTATGTAGAGGG - Intronic
1009679434 6:66872906-66872928 CATTTAAAGCAGTAGGTAGAAGG - Intergenic
1010038853 6:71358500-71358522 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1010521829 6:76847625-76847647 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1011295170 6:85818910-85818932 CATTCAATGCAGTATGTAGAGGG + Intergenic
1011318425 6:86062945-86062967 CATTTAAGGCAGTATTTAGAGGG - Intergenic
1012362003 6:98393700-98393722 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1012508133 6:99972713-99972735 CATTCAAAGCAGTATGTAGAGGG - Intronic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1015133296 6:129838425-129838447 CATTTAAAGCAGTATGTAGAGGG + Intronic
1016063637 6:139656044-139656066 GATGAAAGAAGGTAGGTAGAAGG - Intergenic
1016210327 6:141524508-141524530 CATGGAAGGCAGTACTAAGAGGG + Intergenic
1016358368 6:143242103-143242125 GAGGAAAAGCAGTAGGGAGAAGG + Intronic
1016397627 6:143642514-143642536 CATGCAAGGCTGTAGGGACACGG - Intronic
1020810257 7:12842524-12842546 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1021319747 7:19195088-19195110 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1022267877 7:28775421-28775443 CATGATAGGTAGTGGATAGATGG - Intronic
1022696479 7:32710988-32711010 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1023074881 7:36472771-36472793 CTTGAGAGACAGCAGGTAGATGG + Intergenic
1023084420 7:36556135-36556157 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1023155133 7:37242957-37242979 CAAAACAGGCAGAAGGTAGAGGG - Intronic
1023207692 7:37768736-37768758 AATGAAAAGAAGTAGGAAGAAGG + Intronic
1023462269 7:40411610-40411632 CAGGAAAGGTAGCAGGGAGAGGG + Intronic
1023671654 7:42583722-42583744 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1023687361 7:42749975-42749997 CCTGAAAGTCACAAGGTAGAAGG - Intergenic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024212873 7:47221220-47221242 CATGAAAGGCTGAATGGAGAGGG + Intergenic
1024237449 7:47409060-47409082 GATGAATGACAGTAGGAAGAAGG + Intronic
1024694022 7:51836616-51836638 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1025312473 7:57965452-57965474 CATGCAAAGCAGTGTGTAGAGGG - Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1027921974 7:84405888-84405910 CATTCAAAGCAGTATGTAGAGGG + Intronic
1027964699 7:84990595-84990617 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1028159331 7:87467885-87467907 CATTTAAAGCAGTGGGTAGAGGG + Intronic
1028214391 7:88113871-88113893 CATGAATGGAGGTAGGTAGCAGG + Intronic
1028326195 7:89528047-89528069 CATGGATGGCAGCAGGCAGAAGG + Intergenic
1028508172 7:91592634-91592656 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1028682879 7:93558218-93558240 GATACAAGGCAGTAGGTAGAAGG - Intronic
1029006262 7:97213190-97213212 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029313443 7:99689007-99689029 CATTCAAAGCAGTATGTAGAGGG + Intronic
1030458047 7:109797959-109797981 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1030534322 7:110746742-110746764 CATGTAAAGCAGTGTGTAGAGGG + Intronic
1030607486 7:111653470-111653492 CATGGATGGCAGTAGGCAGAGGG + Intergenic
1030681647 7:112440643-112440665 GATGAAAGGCAGTAGGAAGTAGG - Intronic
1031222288 7:118984135-118984157 CATCAAAAGCAGTACTTAGAGGG + Intergenic
1031527330 7:122837268-122837290 CATTTAAAGCAGTGGGTAGAGGG + Intronic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032446624 7:131989804-131989826 CATGAAGGGCAGAAGGCACAAGG - Intergenic
1032575096 7:133045025-133045047 CAGGAAAAGCTTTAGGTAGAGGG - Intronic
1034120339 7:148621035-148621057 CAAGAGAGGCAGTAGGTCGAAGG - Intergenic
1034583082 7:152063613-152063635 CATTTAAAGCAGTGGGTAGAGGG - Intronic
1036824723 8:11967152-11967174 CATGAGAGGCAGTAGGGACAGGG - Intergenic
1039170646 8:34741025-34741047 CATTTAAAGCAGTATGTAGAAGG + Intergenic
1040627671 8:49169618-49169640 CATCAAAAGCAGTACTTAGAAGG - Intergenic
1040944449 8:52869046-52869068 CATGAGAGGCAGCTGGGAGAGGG - Intergenic
1040981043 8:53246412-53246434 CATGACAGGCAGGAGGATGAAGG + Intronic
1041015231 8:53586322-53586344 CATGTAAAGCAGTGGGTAAATGG + Intergenic
1041669766 8:60480370-60480392 CATGAATGGCAGCAGGTATCTGG + Intergenic
1041997965 8:64086643-64086665 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1042010839 8:64242949-64242971 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1042016560 8:64319873-64319895 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1044156762 8:88857781-88857803 CATGCAAAGCAGTGTGTAGAGGG - Intergenic
1044470360 8:92559975-92559997 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1044808796 8:96036265-96036287 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1044956342 8:97485261-97485283 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1045433467 8:102135733-102135755 CATGCAAAGCAGTGTGTAGAGGG + Intergenic
1045933247 8:107651348-107651370 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1046162807 8:110389340-110389362 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1046443771 8:114288038-114288060 CATGAGAGACAGTATGTATATGG + Intergenic
1046828741 8:118720869-118720891 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047986485 8:130240130-130240152 CACAAAAGGAAGTAGGTAGATGG - Intronic
1048971735 8:139648862-139648884 CAGGAAAGGCAGTGGGGGGATGG - Intronic
1051106534 9:13587294-13587316 AATGACAGGAAGTAGGAAGATGG - Intergenic
1051584665 9:18714089-18714111 CATTCAAGGCAGTGTGTAGAGGG + Intronic
1051781690 9:20695656-20695678 CAGGTAAGTTAGTAGGTAGATGG - Intronic
1051847014 9:21463509-21463531 CATGGATGGCAGCAGGCAGAGGG + Intergenic
1052063863 9:23992699-23992721 CATCAAAGACAAAAGGTAGATGG + Intergenic
1052410403 9:28115064-28115086 CATTCAAAGCAGTATGTAGAGGG - Intronic
1052724635 9:32214982-32215004 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1052846549 9:33341251-33341273 CATGGATGGCAGCAGGCAGAGGG + Intronic
1052888253 9:33670322-33670344 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1054753915 9:68937756-68937778 CATGTAAAGCAGTGTGTAGAGGG - Intronic
1055832752 9:80401531-80401553 CCTGAATGGCAGTTGGTTGAAGG - Intergenic
1057965776 9:99501593-99501615 CATTCAAGGCAGTGTGTAGAGGG + Intergenic
1058074287 9:100635042-100635064 CATTTAAAGCAGTATGTAGAGGG - Intergenic
1058081687 9:100707617-100707639 CATTTAAAGCAGTATGTAGAAGG - Intergenic
1059208880 9:112492509-112492531 CATGAAAGGCAGTAGGTAGAGGG - Intronic
1060053578 9:120393958-120393980 CATGAAAGACTGTAGGTGGCAGG - Intronic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1203517915 Un_GL000213v1:20739-20761 CATGTAAAGCAGTATGTAGAGGG - Intergenic
1203399751 Un_KI270519v1:75714-75736 CATTCAAAGCAGTTGGTAGAAGG + Intergenic
1185530081 X:810602-810624 GATGAAAGAGAGTAGATAGATGG + Intergenic
1185806932 X:3066585-3066607 CAAGAAAGGCTGTAGGTATTTGG + Intronic
1187307347 X:18107740-18107762 CATGCAAAGCAGTGTGTAGAGGG + Intergenic
1187778601 X:22792067-22792089 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1187816834 X:23241369-23241391 CATGCAAAGCAGTGTGTAGAGGG + Intergenic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188123369 X:26336967-26336989 CATGTAAAGCAGTGTGTAGAGGG + Intergenic
1189330531 X:40141991-40142013 CATGAAAGACAGTGGGTGAAGGG - Intronic
1189978139 X:46483212-46483234 CATGTAAAGCAGTGTGTAGAGGG - Intronic
1190593464 X:52028771-52028793 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1191028295 X:55939366-55939388 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1191039809 X:56067428-56067450 CATGAGAGGCAGTGCCTAGATGG + Intergenic
1191762335 X:64659367-64659389 CATGTAAAGCAGTACATAGAGGG - Intergenic
1191811314 X:65191952-65191974 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1191876207 X:65799467-65799489 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1191939427 X:66462414-66462436 CAGTAAAGGCTGCAGGTAGAAGG - Intergenic
1192481626 X:71491254-71491276 CAGTTAAGGCAGGAGGTAGAAGG + Intronic
1193002397 X:76577603-76577625 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1193054421 X:77135130-77135152 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1193321129 X:80122729-80122751 CATGAAATCCTGTTGGTAGAAGG - Intergenic
1193387700 X:80890762-80890784 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1193735346 X:85149804-85149826 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1193766255 X:85532056-85532078 CATTCAAAGCAGTGGGTAGAGGG + Intergenic
1194628774 X:96257358-96257380 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1194630082 X:96272354-96272376 CATGCAAAGCAGTGTGTAGAGGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195440449 X:104892944-104892966 CATTTAAAGCAGTATGTAGAGGG - Intronic
1195441821 X:104907454-104907476 CATTCAAGGCAGTGTGTAGAGGG - Intronic
1195453117 X:105037807-105037829 CATGAAAGGAAGTAGAGAAATGG - Intronic
1195508540 X:105687063-105687085 CATTTAAAGCAGTATGTAGAGGG + Intronic
1195733436 X:107989236-107989258 CATGCAAAGCAGTGTGTAGAGGG - Intergenic
1195736127 X:108014385-108014407 CATGCAAAGCAGTATGTAGAGGG + Intergenic
1196159295 X:112464811-112464833 CATTTAAAGCAGTATGTAGAGGG + Intergenic
1196359292 X:114833852-114833874 CATTCAAAGCAGTATGTAGAGGG - Intronic
1196482168 X:116162181-116162203 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1197465777 X:126803155-126803177 CATGTAAAGCAGTGTGTAGAGGG - Intergenic
1197575126 X:128201913-128201935 CATTAAAAGCAGTCTGTAGAGGG + Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1197957117 X:131963436-131963458 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1198165059 X:134047317-134047339 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1200784962 Y:7252711-7252733 CATTCAAGGCAGTGTGTAGAGGG - Intergenic
1200871111 Y:8099611-8099633 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1200899229 Y:8411113-8411135 CATTCAAAGCAGTATGTAGAGGG - Intergenic
1201262335 Y:12171960-12171982 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1201645017 Y:16221014-16221036 CATGCAAAGCAGTCTGTAGAGGG - Intergenic
1201657797 Y:16364308-16364330 CATGCAAAGCAGTCTGTAGAGGG + Intergenic
1201725391 Y:17144752-17144774 CATGATAGGAAGTTGGAAGAGGG - Intergenic
1201740104 Y:17314612-17314634 CATTCAAAGCAGTATGTAGAGGG + Intergenic
1202253714 Y:22899137-22899159 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1202406704 Y:24532886-24532908 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1202464077 Y:25137195-25137217 CATTTAAGGCAGTGTGTAGAGGG + Intergenic