ID: 1059209042

View in Genome Browser
Species Human (GRCh38)
Location 9:112494531-112494553
Sequence GACACTGCTGTAAACCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059209042_1059209044 -5 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC 0: 1
1: 0
2: 0
3: 18
4: 254
Right 1059209044 9:112494549-112494571 GTGTCAACGTCTCTGGCCTCAGG No data
1059209042_1059209050 27 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC 0: 1
1: 0
2: 0
3: 18
4: 254
Right 1059209050 9:112494581-112494603 CAGTTTAGCCCCAAGTAGCTGGG No data
1059209042_1059209049 26 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC 0: 1
1: 0
2: 0
3: 18
4: 254
Right 1059209049 9:112494580-112494602 CCAGTTTAGCCCCAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059209042 Original CRISPR GACACTGCTGTAAACCATGA TGG (reversed) Intronic
904195461 1:28782087-28782109 GTCCCTGCTGTAAAACCTGAAGG - Intergenic
904601794 1:31677016-31677038 GGCACTGCTCTAAGCCCTGATGG - Intronic
906521619 1:46470043-46470065 GACACAGCTGGAAACCAGCAGGG + Intergenic
907048514 1:51314554-51314576 GACACTCCTGTGATCCTTGAGGG + Intronic
907951094 1:59184805-59184827 GAGACTGTTGTAAGCTATGATGG - Intergenic
908657202 1:66400946-66400968 GAGACTGCAGTGAACCCTGACGG - Intergenic
912462847 1:109848204-109848226 GAGACTGCAGTGAGCCATGATGG + Intergenic
912572834 1:110637130-110637152 GAGACTGCAGTGAACCGTGATGG + Intergenic
912764676 1:112397282-112397304 GAGACTGCAGTTAACCTTGAAGG + Intronic
915187910 1:154122984-154123006 AAGGCTGCAGTAAACCATGATGG + Intronic
918301829 1:183211573-183211595 GAGGCTGCAGTAAGCCATGATGG - Intronic
918334405 1:183494050-183494072 GAGACTGCAGTGAGCCATGATGG - Intronic
918828057 1:189353249-189353271 GACACTGCAGTAAACATGGAAGG + Intergenic
920225998 1:204439697-204439719 GAGGCTGCAGTAAGCCATGATGG - Intronic
920437531 1:205957157-205957179 GACACTGCTGATAAAGATGATGG - Intergenic
921064400 1:211612441-211612463 GAGGCTGCTGTGAGCCATGATGG - Intergenic
923312854 1:232752962-232752984 GAGAATGCTGTGAGCCATGATGG - Intergenic
923790827 1:237109853-237109875 AACATTGCTGAACACCATGAAGG - Intronic
924646606 1:245883643-245883665 AAGGCTGCTTTAAACCATGAAGG - Intronic
1063101872 10:2957190-2957212 GATGCTGCGGTAAGCCATGATGG + Intergenic
1063913440 10:10855329-10855351 GACACTGCTGTCACCTAGGATGG + Intergenic
1064287856 10:14008146-14008168 CACACAGCTGTACACCATGGTGG - Intronic
1064983220 10:21184968-21184990 AACTCTTCTGTAAAGCATGAGGG + Intergenic
1065397618 10:25256618-25256640 GAGACTGCAGTGAGCCATGATGG + Intronic
1065549642 10:26857577-26857599 GAGGCTGCAGTAAGCCATGATGG + Intronic
1066305587 10:34137337-34137359 CACAATGCTGTCAACAATGACGG + Intronic
1067305541 10:45060569-45060591 GAGACTGCTGTGAGCCAAGATGG + Intergenic
1067490130 10:46690585-46690607 GAAACTGCAGTGAGCCATGATGG + Intergenic
1067604535 10:47649791-47649813 GAAACTGCAGTGAGCCATGATGG - Intergenic
1071620091 10:87111224-87111246 GAAACTGCAGTGAGCCATGATGG - Intronic
1072781773 10:98256410-98256432 GAGAGTGCTGTCAAACATGAGGG - Intronic
1073936636 10:108640439-108640461 GAGGCTGCAGTAAGCCATGATGG - Intergenic
1077513890 11:2989361-2989383 GTTACTGCTTGAAACCATGATGG - Intronic
1078087832 11:8244797-8244819 GGTGCTGCTGAAAACCATGAGGG - Intronic
1078383592 11:10866675-10866697 GAGACTGCTGTGAGCCATGATGG + Intergenic
1080618795 11:33968921-33968943 GAGTCTGCCGTAAGCCATGATGG + Intergenic
1082995464 11:59251052-59251074 GAAAGTGCTGAGAACCATGAGGG - Intergenic
1083898594 11:65632807-65632829 GACACTGCAGTGAACCCAGATGG - Intronic
1084254417 11:67929913-67929935 GAGGCTGCTGTGAGCCATGACGG + Intergenic
1084818453 11:71665970-71665992 GAGGCTGCTGTGAGCCATGACGG - Intergenic
1085481285 11:76824900-76824922 GAGGCTGCGGTGAACCATGATGG + Intergenic
1086734828 11:90293320-90293342 GACACTTTTGTAAATAATGATGG + Intergenic
1087609660 11:100418992-100419014 GACAAAGCTTTTAACCATGATGG - Intergenic
1088149170 11:106723500-106723522 GTCACTGCTGTGTACCAGGAAGG - Intronic
1088498689 11:110459676-110459698 GACACTTCTGCAAACCTGGAAGG - Intronic
1091221726 11:133933681-133933703 GAGTCTGCAGTAAGCCATGATGG + Intronic
1091724372 12:2835219-2835241 GACAGTGCTGTAAACTGTCAGGG + Intronic
1094006813 12:25762362-25762384 GAGGCTGCAGTGAACCATGATGG + Intergenic
1094658559 12:32444087-32444109 GAGACTGCAGTGAGCCATGATGG - Intronic
1095503460 12:42866529-42866551 GAGACTGCAGTGAACCGTGATGG - Intergenic
1095851506 12:46813053-46813075 GACACTGATGTCAACCATTCTGG - Intronic
1097090915 12:56504060-56504082 GAGGCTGCAGTAAGCCATGATGG - Intergenic
1098914158 12:76240000-76240022 GAGGCTGCAGTAATCCATGATGG + Intergenic
1099120060 12:78678292-78678314 CACACTACTGTAAACAACGATGG + Intergenic
1099217377 12:79869613-79869635 CACACTGATGTAAACCAGTAGGG + Intronic
1099746994 12:86718174-86718196 AACCCTGATCTAAACCATGATGG + Intronic
1102364508 12:112320268-112320290 GAGGCTGCAGTAAGCCATGATGG + Intronic
1102366895 12:112345186-112345208 GAGGCTGCAGTAAGCCATGATGG + Intronic
1102977410 12:117216540-117216562 GAGACTGCAGTGAGCCATGATGG - Intronic
1103142755 12:118564375-118564397 GAGGCTGCAGTGAACCATGATGG + Intergenic
1103754781 12:123195968-123195990 GAGACTGCAGTAAGCCATGACGG + Intronic
1103991667 12:124803503-124803525 CAGACTGCTGTGAGCCATGATGG + Intronic
1104121668 12:125805790-125805812 GACCCTCCTGGCAACCATGAAGG - Intergenic
1104837028 12:131798237-131798259 GAGGCTGCTGTGAGCCATGACGG + Intronic
1107151061 13:37112216-37112238 GAGACTGCAGTAAGCTATGATGG + Intergenic
1109329821 13:60915260-60915282 GACACTGCTCAAAAGCATAAGGG - Intergenic
1109779881 13:67095207-67095229 GACACAGCTGTATCCCATGCTGG - Intronic
1112850124 13:103696131-103696153 GAGGCTGCAGTAAACTATGATGG - Intergenic
1113768856 13:112896022-112896044 GAAACTGCTGGAATCCGTGAAGG + Intronic
1114149525 14:20021678-20021700 GCCAGTGCTGTAAATCAGGATGG + Intergenic
1114210274 14:20608150-20608172 GACACAGCTGGAGACCATGCAGG - Intronic
1115834546 14:37385155-37385177 GAAACTGCTGTAAAATATGGTGG + Intronic
1116024520 14:39498610-39498632 GAGACTGCAGTGAACCATGATGG + Intergenic
1116969182 14:51047128-51047150 GACACTTGTGTTTACCATGAAGG + Intronic
1117068421 14:52033657-52033679 GATACTGCTGTGTACCAAGAGGG + Intronic
1117331298 14:54714781-54714803 GCCTCTGCAGTAAACTATGATGG + Intronic
1118576899 14:67251466-67251488 GAGGCTGCAGTGAACCATGATGG + Intronic
1119434979 14:74592632-74592654 GAGGCTGCAGTGAACCATGATGG + Intronic
1120320841 14:82958233-82958255 GAGGCTGCAGTAAACTATGATGG - Intergenic
1120669900 14:87351263-87351285 GACACTGCTCAAAGCCCTGATGG - Intergenic
1122141473 14:99665503-99665525 GAGGCTGCAGTAAGCCATGATGG - Intronic
1122581596 14:102775286-102775308 GAAGCTGCTGTGAGCCATGATGG - Intergenic
1122988276 14:105223126-105223148 GACACTGCAGTGAGCTATGATGG + Intronic
1123724521 15:23088708-23088730 GACCCGGCTGGATACCATGAAGG + Intergenic
1124404037 15:29378298-29378320 GAAAATACTGTAAACAATGATGG - Intronic
1125393771 15:39225218-39225240 GACACTGATGAAAAGCAAGAGGG - Intergenic
1128669503 15:69563939-69563961 GAGGCTGCTGTGAGCCATGATGG - Intergenic
1128841934 15:70857429-70857451 GAGGCTGCAGTGAACCATGATGG + Intronic
1129132707 15:73515002-73515024 GAGGCTGCAGTAAGCCATGATGG - Intronic
1129408297 15:75334302-75334324 GAGGCTGCAGTGAACCATGATGG - Intergenic
1129873357 15:78956005-78956027 GCCCTTGCTGTAAGCCATGAGGG - Intergenic
1133471190 16:6077439-6077461 GTCACTGCTGCGAACCAGGAAGG + Intronic
1134126673 16:11620958-11620980 GAGGCTGCAGTAAGCCATGATGG - Intronic
1135058412 16:19250452-19250474 GAGACTGCAGTGAGCCATGATGG - Intronic
1135117986 16:19739748-19739770 GAGTCTGCAGTGAACCATGATGG + Intronic
1135569379 16:23536595-23536617 GAGGCTGCAGTAAACTATGATGG + Intronic
1135761439 16:25141408-25141430 GAGGCTGCAGTAAGCCATGATGG - Intronic
1135776867 16:25264311-25264333 GAGGCTGCAGTGAACCATGAGGG + Intergenic
1139637894 16:68269830-68269852 GAGGCTGCAGTGAACCATGATGG - Intronic
1140334901 16:74095932-74095954 GAGGCTGCAGCAAACCATGATGG - Intergenic
1141560031 16:84861863-84861885 GAGGCTGCAGTAAGCCATGATGG + Intronic
1141715600 16:85725084-85725106 GTCCCTGCTGTAAGCCAGGAGGG + Intronic
1142047956 16:87937861-87937883 GAGACTGCAGTGAGCCATGATGG - Intergenic
1142908457 17:3065889-3065911 GACACTGCTGTACTCCAGGCTGG - Intergenic
1142926108 17:3238355-3238377 GACACTGCTGTACTCCAGGCTGG + Intergenic
1143865823 17:9922511-9922533 GACAATGCTCTAAAGCATGGAGG + Intronic
1147223684 17:38957763-38957785 GAGACTGCAGTGAGCCATGATGG - Intronic
1147735952 17:42638420-42638442 GAGACTGCAGTAAGCCATGATGG - Intergenic
1149749628 17:59133040-59133062 GACACTGCAGTGAGCTATGATGG - Intronic
1149880829 17:60288373-60288395 GAGACTGCCGTAAGCCACGATGG + Intronic
1150700213 17:67440594-67440616 GAGACTGCAGTGAGCCATGATGG - Intronic
1151045428 17:70914593-70914615 GACACAGCTCTAATCCATGTTGG + Intergenic
1152830185 17:82492417-82492439 GAGTCTGCAGTAAGCCATGATGG - Intergenic
1153573628 18:6498319-6498341 GAAAATGGTGTAAAACATGATGG + Intergenic
1154069399 18:11139977-11139999 GACTCTGCTGTTCTCCATGATGG + Intronic
1155367434 18:25062980-25063002 GAACCTGCTGTCACCCATGAGGG + Intronic
1155481245 18:26290202-26290224 GAGGCTGCAGTGAACCATGATGG - Intronic
1155728526 18:29121377-29121399 GACACTGCAGTGAGCTATGATGG - Intergenic
1156371188 18:36472855-36472877 AACACTGCTGTGAACATTGAAGG + Intronic
1157772055 18:50357933-50357955 GAGGCTGCAGTAAGCCATGATGG - Intergenic
1157969404 18:52248882-52248904 GAGGCTGCAGTAAACCATGATGG + Intergenic
1160057355 18:75495926-75495948 GACACTCCTGAAATACATGATGG + Intergenic
1161424062 19:4192561-4192583 GTCACTGCTGTATTCCATGCAGG - Intronic
1161627069 19:5333441-5333463 GACACTGCAGTGAGCCATTATGG + Intronic
1162075274 19:8182583-8182605 GACACTGCAGTGAACTGTGATGG + Intronic
1162159953 19:8704614-8704636 GACATTGCAGTGAACCAAGATGG - Intergenic
1162717953 19:12645717-12645739 GAGGCTGCAGTGAACCATGATGG - Intronic
1164039375 19:21481841-21481863 GAGGCTGCAGTAAGCCATGATGG + Intronic
1165478771 19:36048781-36048803 GAGGCTGCAGTGAACCATGATGG + Intronic
1165780068 19:38427296-38427318 GAGGCTGCAGTGAACCATGATGG + Intergenic
1166742705 19:45123931-45123953 GCCACTGCAGTAGACCCTGAAGG - Intronic
1168196745 19:54780339-54780361 CACACAGCTGTCAGCCATGAAGG + Intronic
1168479412 19:56706473-56706495 GGCACTGCTCTAAACCATTGGGG - Intergenic
1168600401 19:57713500-57713522 GAGGCTGCAGTGAACCATGATGG - Intronic
926670146 2:15569197-15569219 GAGACTGCTGTGAGCTATGACGG + Intergenic
927563892 2:24094102-24094124 AACACTGCAGTAAGCTATGATGG - Intronic
927681949 2:25145507-25145529 AAGGCTGCTGTAAGCCATGATGG + Intronic
927890418 2:26744595-26744617 GAAACTGCTGGAAACCACTAGGG - Intergenic
929664439 2:43822805-43822827 CACACTGCTGAAAATCATGGTGG + Exonic
931037026 2:58255063-58255085 GAGGCTGCAGTAAGCCATGATGG - Intergenic
931402562 2:61944384-61944406 GAGACTGCAGTGAGCCATGATGG + Intronic
931762153 2:65427662-65427684 GAAAATGCTGTGAAGCATGAGGG - Intronic
933625608 2:84595017-84595039 GCCACTGCTCTAATCCATGGTGG - Intronic
933828700 2:86188486-86188508 GAGGCTGCAGTGAACCATGATGG - Intronic
934532487 2:95102595-95102617 GAGACTGCAGTAAGCCTTGATGG + Intronic
936223813 2:110628268-110628290 GACGCTGCAGTAAGCCATGATGG - Intergenic
936653170 2:114453605-114453627 GTTACTCCTGTTAACCATGAGGG - Intronic
939020686 2:136954650-136954672 GAGACTGCAGTAAGCCAAGATGG + Intronic
944023503 2:195135836-195135858 GACACTGATTGAAACCAAGAGGG - Intergenic
945414653 2:209556103-209556125 GAGGCTGCAGTAAACTATGATGG - Intronic
947621749 2:231595224-231595246 GACTCTGCTGGGAACCAGGAAGG - Intergenic
948273248 2:236689638-236689660 GAGGCTGCAGTAAGCCATGATGG - Intergenic
948987784 2:241535824-241535846 GAGACTGCAGTAAGCCGTGATGG + Intergenic
1170140341 20:13119664-13119686 GACACTGCAGTGTAACATGAAGG - Intronic
1171955467 20:31459174-31459196 GACACTGCTGTGAACTGAGATGG - Intergenic
1172450882 20:35021775-35021797 GACACTGCTGAAGCCCAAGAGGG + Intronic
1172556600 20:35847413-35847435 GTCACTGCTGTTAACAAGGATGG + Exonic
1174001707 20:47379614-47379636 GAGGCTGCAGTGAACCATGATGG - Intergenic
1174691624 20:52511936-52511958 GAGGCTGCAGTAAGCCATGATGG + Intergenic
1177781790 21:25629935-25629957 AACACTGCTGGAAACCATTGAGG + Intergenic
1180011209 21:45052697-45052719 GAGGCTGCAGTGAACCATGATGG + Intergenic
1180611746 22:17102739-17102761 GAGACTACAGTAAGCCATGATGG + Intronic
1183991916 22:41602777-41602799 GACTGTGCTGTAATACATGAGGG + Intronic
949974568 3:9444188-9444210 GACAGTGCAGAAAACCATAAAGG + Intronic
950034114 3:9872236-9872258 GACACTGCAGTGAGTCATGATGG - Intronic
950168622 3:10820421-10820443 GCCACTGCTGTCAAGCAGGAAGG - Intronic
952636233 3:35536175-35536197 GATACTGTTGTAAATAATGAAGG + Intergenic
953862180 3:46554082-46554104 GAGGCTGCAGTGAACCATGATGG - Intronic
955044769 3:55349512-55349534 GGAACTGCTGTCAAACATGAGGG + Intergenic
955545849 3:60029294-60029316 CACACTGCTGTATAAGATGAGGG + Intronic
955560383 3:60182716-60182738 GACACTGCAGTGAGCTATGATGG + Intronic
956251117 3:67235304-67235326 GAGACTGCAGTGACCCATGATGG - Intergenic
956496172 3:69828826-69828848 GACACTTATATAAACCATCAAGG - Intronic
958080981 3:88746000-88746022 GAGGCTGCAGTAAACTATGAGGG - Intergenic
959839511 3:110958550-110958572 GCCACTGCTGAAACCCCTGATGG + Intergenic
960036254 3:113105599-113105621 GACAGTGCTGAAAACCAGTAAGG - Intergenic
961862934 3:129932135-129932157 GAGACTGCAGTGAGCCATGATGG - Intergenic
965101335 3:164302596-164302618 GACAGTGCTGTGAACCTTGATGG - Intergenic
966394576 3:179488917-179488939 GAGACTGCAGTAAGCCAAGATGG + Intergenic
966720842 3:183061428-183061450 CCCACTGCTGTAAAACATGAGGG + Intronic
968059365 3:195715531-195715553 GAGGCTGCAGTGAACCATGATGG + Intergenic
968563769 4:1298571-1298593 GACACTGCTGAGACCCATGATGG + Intronic
969948767 4:10812067-10812089 GACACTTCTGTATTCCAGGAAGG + Intergenic
971800985 4:31290808-31290830 GTAACTGTTGTAAACCATTAGGG + Intergenic
976202340 4:82591812-82591834 AACACTGCTTTAACCCTTGAAGG + Intergenic
977477907 4:97536859-97536881 AACACTGCTATAAACAATGAAGG + Intronic
980114831 4:128669404-128669426 GAGACTGCAGTGAGCCATGATGG - Intergenic
981266671 4:142792186-142792208 GAGACTGCAGTGAACAATGATGG + Intronic
981593090 4:146387141-146387163 GACACTAGTCTAAATCATGAGGG - Intronic
982032785 4:151317234-151317256 CAAACTGCTGTAAACTATGTCGG + Intronic
983445945 4:167852582-167852604 GAGACTGCAGTGAACCAAGATGG - Intergenic
984096305 4:175439260-175439282 GAGACTGCAGTGAGCCATGATGG - Intergenic
984306175 4:177994687-177994709 GAGGCTGCAGTGAACCATGATGG + Intergenic
984958312 4:185068373-185068395 GTTGCTGCTGTAAACCATAATGG - Intergenic
989101404 5:37826617-37826639 GACACTGCTCTAAGCCATAGTGG - Intronic
991222125 5:64228447-64228469 GAGACTGCAGTAAGCCATGATGG + Intronic
999255057 5:150205457-150205479 GACGATGCTATACACCATGAGGG - Exonic
999736468 5:154517045-154517067 GAGACTGCAGTGAGCCATGATGG + Intergenic
1000748429 5:165064998-165065020 GACACTATTTTAAACCATCATGG - Intergenic
1001602391 5:172937603-172937625 GACACTGCAGTGGGCCATGATGG + Intronic
1001609166 5:172986164-172986186 GACATTGCTGTATACCATGGTGG + Intronic
1001613457 5:173022696-173022718 GAGGCTGCAGTAAGCCATGATGG - Intronic
1005213266 6:23494532-23494554 GGCACTGCCGTGCACCATGACGG - Intergenic
1005257360 6:24017428-24017450 GAAATTGCTGTAAAACAAGATGG - Intergenic
1006350230 6:33515490-33515512 GAGGCTGCAGTGAACCATGATGG + Intergenic
1008906422 6:56682235-56682257 AACACTGCAGTGAGCCATGATGG - Intronic
1010210499 6:73359356-73359378 GAGGCTGCTGTGAACTATGATGG + Intergenic
1012474008 6:99601974-99601996 GAGGCTGCAGTGAACCATGATGG + Intergenic
1013040667 6:106430334-106430356 GAGGCTGCAGTAAGCCATGATGG + Intergenic
1013602165 6:111715155-111715177 CAAACTTCTGTAAACCAGGAAGG - Intronic
1013925890 6:115472152-115472174 GAGGCTGCAGTGAACCATGATGG - Intergenic
1014093736 6:117436492-117436514 GATACTGCAGTAAGACATGATGG - Intronic
1014817289 6:125950017-125950039 GAAACTGCTGTTCACCAAGATGG - Intergenic
1015388673 6:132655442-132655464 GAGGCTGCAGTGAACCATGATGG - Intergenic
1017074844 6:150608112-150608134 GACACACCTGTGGACCATGAGGG - Intronic
1018447508 6:163870934-163870956 GAGGCTGCAGTAAGCCATGATGG + Intergenic
1020921130 7:14265726-14265748 GATACTGTTGTCAACCATGAGGG - Intronic
1021341499 7:19468635-19468657 TAGACTCCTGTAAGCCATGATGG - Intergenic
1022663884 7:32390786-32390808 GAGACTGTAGTGAACCATGATGG + Intergenic
1022692585 7:32671199-32671221 GAAAATGCAGTAAGCCATGATGG + Intergenic
1022705594 7:32799293-32799315 GAGGCTGCAGTTAACCATGATGG - Intergenic
1023105308 7:36758211-36758233 GAGGCTGCAGTAAGCCATGATGG + Intergenic
1025113593 7:56239385-56239407 GACACAGCTGGAAACAGTGAAGG - Intergenic
1025207155 7:57000475-57000497 GACACAGGTGTCAACCCTGAAGG - Intergenic
1025664781 7:63576415-63576437 GACACAGGTGTCAACCCTGAAGG + Intergenic
1026018642 7:66691990-66692012 GAGACTGCAGTGAGCCATGATGG + Intronic
1026072325 7:67133199-67133221 GAGACTGCAGTGAGCCATGATGG - Intronic
1026231965 7:68492175-68492197 GACAATGATGTTAACAATGAGGG + Intergenic
1026338880 7:69418697-69418719 GAGACTGCAGTGAACTATGATGG - Intergenic
1027380724 7:77606459-77606481 GAGGCTGCAGTAAGCCATGATGG - Intronic
1028071329 7:86454435-86454457 GAGGCTGCAGTAAGCCATGATGG + Intergenic
1028617963 7:92791247-92791269 AACACTGCTGTATCTCATGAGGG - Intronic
1029158629 7:98535183-98535205 GAGGCTGCAGTAAACTATGATGG - Intergenic
1029670982 7:102030748-102030770 GAGGCTGCAGTGAACCATGATGG - Intronic
1032092282 7:128916914-128916936 GAGACTGCAGTGAGCCATGATGG + Intergenic
1034966786 7:155396454-155396476 GAGGCTGCAGTGAACCATGATGG + Intergenic
1035586545 8:779526-779548 GACGCTGCAGTGAACTATGATGG - Intergenic
1037318934 8:17625928-17625950 GAAACTGCAGTAAGTCATGATGG + Intronic
1038678529 8:29645280-29645302 GACAGTGCAGCAAACCATAATGG + Intergenic
1038775120 8:30522441-30522463 AAGACTGCAGTAAGCCATGATGG + Intronic
1039239308 8:35537613-35537635 GAGGCTGCAGTAAACTATGATGG + Intronic
1039564896 8:38544289-38544311 GAGGCTGCAGTGAACCATGATGG + Intergenic
1039908643 8:41806638-41806660 GAGGCTGCAGTGAACCATGATGG + Intronic
1043793178 8:84499817-84499839 GAGGCTGCAGTAAGCCATGATGG - Intronic
1043888863 8:85633845-85633867 GTCACTCCTGTCAACCATGCTGG - Intergenic
1047773548 8:128049921-128049943 GACACTGCTGTATCCCCTGAGGG + Intergenic
1048689944 8:136950897-136950919 GACACTTCTGTAATACATGAGGG - Intergenic
1049309341 8:141925040-141925062 GTCACTGATGTAACCCATGTGGG - Intergenic
1049607608 8:143536917-143536939 AACTCTGCTCTAAACCATGCTGG - Intronic
1051050516 9:12927174-12927196 GAGACTGGTGTAGGCCATGATGG + Intergenic
1051819741 9:21150365-21150387 TACACTGCAGTAAACCTTCAAGG + Intergenic
1051873226 9:21763075-21763097 GAGACTGCAGTGAGCCATGATGG + Intergenic
1053555749 9:39135335-39135357 GAGGCTGCAGTAAACTATGAAGG - Intronic
1053819868 9:41955593-41955615 GAGGCTGCAGTAAACTATGAAGG - Intronic
1054110134 9:61099252-61099274 GAGGCTGCAGTAAACTATGAAGG - Intergenic
1054610723 9:67231873-67231895 GAGGCTGCAGTAAACTATGAAGG + Intergenic
1056853684 9:90106378-90106400 GACACTGCTGTCATCCATAAAGG + Intergenic
1057742401 9:97723297-97723319 GACACTGCAGTGAACCAAGATGG - Intergenic
1057854154 9:98589777-98589799 GAGGCTGCTGTGAGCCATGATGG - Intronic
1059209042 9:112494531-112494553 GACACTGCTGTAAACCATGATGG - Intronic
1059869447 9:118555423-118555445 GAGGTTGCAGTAAACCATGATGG + Intergenic
1061462129 9:130748475-130748497 GAGACTGCAGTAAGCCAAGATGG - Intronic
1186280494 X:7988055-7988077 GCCACAGCTGAAAACAATGACGG + Intergenic
1186312670 X:8337687-8337709 GAGGCTGCTGTAAGCTATGATGG - Intergenic
1190753991 X:53384878-53384900 GAGGCTGCAGTGAACCATGATGG + Intronic
1191994953 X:67083601-67083623 AATAGTGCTGAAAACCATGAGGG + Intergenic
1196762469 X:119211862-119211884 GACACTGCTGTCAACACTGAGGG + Intergenic
1197114453 X:122816666-122816688 GACAGTGGTGTCAACCAGGATGG - Intergenic
1197209368 X:123816436-123816458 GAGGCTGCAGTAAGCCATGATGG + Intergenic
1197255609 X:124259867-124259889 GGCACTGCTGTGTGCCATGATGG + Intronic
1198235179 X:134730507-134730529 GAGGCTGCTGTAAGCTATGATGG - Intronic
1202303785 Y:23446358-23446380 GAGACTGCAGTGAGCCATGATGG - Intergenic
1202567025 Y:26224235-26224257 GAGACTGCAGTGAGCCATGATGG + Intergenic