ID: 1059209042

View in Genome Browser
Species Human (GRCh38)
Location 9:112494531-112494553
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059209042_1059209050 27 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC No data
Right 1059209050 9:112494581-112494603 CAGTTTAGCCCCAAGTAGCTGGG No data
1059209042_1059209044 -5 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC No data
Right 1059209044 9:112494549-112494571 GTGTCAACGTCTCTGGCCTCAGG No data
1059209042_1059209049 26 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC No data
Right 1059209049 9:112494580-112494602 CCAGTTTAGCCCCAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059209042 Original CRISPR GACACTGCTGTAAACCATGA TGG (reversed) Intronic