ID: 1059209045

View in Genome Browser
Species Human (GRCh38)
Location 9:112494565-112494587
Sequence TAAACTGGGAGGATCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27865
Summary {0: 1, 1: 6, 2: 124, 3: 2672, 4: 25062}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059209045_1059209050 -7 Left 1059209045 9:112494565-112494587 CCTCAGGTGATCCTCCCAGTTTA 0: 1
1: 6
2: 124
3: 2672
4: 25062
Right 1059209050 9:112494581-112494603 CAGTTTAGCCCCAAGTAGCTGGG No data
1059209045_1059209049 -8 Left 1059209045 9:112494565-112494587 CCTCAGGTGATCCTCCCAGTTTA 0: 1
1: 6
2: 124
3: 2672
4: 25062
Right 1059209049 9:112494580-112494602 CCAGTTTAGCCCCAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059209045 Original CRISPR TAAACTGGGAGGATCACCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr