ID: 1059209049

View in Genome Browser
Species Human (GRCh38)
Location 9:112494580-112494602
Sequence CCAGTTTAGCCCCAAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059209042_1059209049 26 Left 1059209042 9:112494531-112494553 CCATCATGGTTTACAGCAGTGTC 0: 1
1: 0
2: 0
3: 18
4: 254
Right 1059209049 9:112494580-112494602 CCAGTTTAGCCCCAAGTAGCTGG No data
1059209045_1059209049 -8 Left 1059209045 9:112494565-112494587 CCTCAGGTGATCCTCCCAGTTTA 0: 1
1: 6
2: 124
3: 2672
4: 25062
Right 1059209049 9:112494580-112494602 CCAGTTTAGCCCCAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059209049 Original CRISPR CCAGTTTAGCCCCAAGTAGC TGG Intronic
No off target data available for this crispr