ID: 1059210531

View in Genome Browser
Species Human (GRCh38)
Location 9:112510748-112510770
Sequence CAGTTCGGTGTAGGGGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059210526_1059210531 -10 Left 1059210526 9:112510735-112510757 CCATGGAGAAAAGCAGTTCGGTG 0: 1
1: 0
2: 0
3: 28
4: 263
Right 1059210531 9:112510748-112510770 CAGTTCGGTGTAGGGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059210531 Original CRISPR CAGTTCGGTGTAGGGGGCAT AGG Intronic
No off target data available for this crispr