ID: 1059213225

View in Genome Browser
Species Human (GRCh38)
Location 9:112534143-112534165
Sequence CTGTGTCATGACATAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059213219_1059213225 19 Left 1059213219 9:112534101-112534123 CCTTCATTTCCTCATCTGTAAAG 0: 3
1: 34
2: 355
3: 1876
4: 6795
Right 1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG No data
1059213218_1059213225 29 Left 1059213218 9:112534091-112534113 CCTCTTTGTGCCTTCATTTCCTC 0: 1
1: 9
2: 93
3: 589
4: 2695
Right 1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG No data
1059213223_1059213225 10 Left 1059213223 9:112534110-112534132 CCTCATCTGTAAAGTGGGGAATA 0: 2
1: 15
2: 195
3: 1358
4: 4672
Right 1059213225 9:112534143-112534165 CTGTGTCATGACATAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059213225 Original CRISPR CTGTGTCATGACATAGAGCT TGG Intronic
No off target data available for this crispr