ID: 1059217022

View in Genome Browser
Species Human (GRCh38)
Location 9:112573792-112573814
Sequence ATAATAATTCCTGCCTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059217022 Original CRISPR ATAATAATTCCTGCCTAAGG GGG (reversed) Intronic