ID: 1059217217

View in Genome Browser
Species Human (GRCh38)
Location 9:112575231-112575253
Sequence ACCTGGTATGCACTGTGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059217217_1059217219 -10 Left 1059217217 9:112575231-112575253 CCACAGCACAGTGCATACCAGGT 0: 1
1: 0
2: 1
3: 17
4: 169
Right 1059217219 9:112575244-112575266 CATACCAGGTATGGCACATGAGG 0: 1
1: 0
2: 1
3: 13
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059217217 Original CRISPR ACCTGGTATGCACTGTGCTG TGG (reversed) Exonic
902399158 1:16148453-16148475 GCCCCGTATGCACTGTGCAGTGG - Exonic
903139054 1:21327640-21327662 ACCTGGTCTGCACGGCCCTGCGG + Intronic
904200831 1:28818106-28818128 ACCTGGCATGCCCTGCGCTGTGG + Intronic
909104721 1:71393684-71393706 ACCTGGGATCCTCTGAGCTGAGG - Intergenic
910239276 1:85069008-85069030 TCATGCTATGCACTGTGGTGTGG - Intronic
911948928 1:104147550-104147572 TCATGGAATGCACTGTGCTCTGG + Intergenic
913524907 1:119681673-119681695 AGCTGGAAGGCAGTGTGCTGGGG + Intronic
914985146 1:152449931-152449953 ACCTGGTATGCAGAGCCCTGGGG + Intergenic
1062911924 10:1217009-1217031 CCCAGGTCTGCACTGCGCTGGGG + Exonic
1063019562 10:2114292-2114314 CCCTGCTGGGCACTGTGCTGGGG - Intergenic
1063214635 10:3913071-3913093 AAGTGGTAGGCAGTGTGCTGAGG - Intergenic
1063602703 10:7496935-7496957 GCTTGTTATGCACTGTGCTGTGG + Intergenic
1063680998 10:8187945-8187967 ACCTGGTTTCCACAGTGCTCTGG - Intergenic
1065488031 10:26253851-26253873 ACCTGGTTTAGAATGTGCTGTGG - Intronic
1066032172 10:31439787-31439809 ACCTGGAATGCAGTGAGCCGGGG + Intronic
1068703160 10:60041832-60041854 TACTGGTATGCAGAGTGCTGAGG - Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069996004 10:72342528-72342550 ACCTGGTGTGCAGTGTCCCGGGG - Intronic
1070867350 10:79714271-79714293 GCCTGATGTGCACTGAGCTGGGG - Intronic
1070881142 10:79852395-79852417 GCCTGATGTGCACTGAGCTGGGG - Intergenic
1074383472 10:112998981-112999003 GTCTGGTATTCACTTTGCTGGGG - Intronic
1075511331 10:123074825-123074847 ACCTGCTATGCCAAGTGCTGGGG - Intergenic
1076307509 10:129475379-129475401 GCCTCTCATGCACTGTGCTGAGG - Intronic
1076387479 10:130067745-130067767 ACCTGCTGTGCCCTGTGCCGAGG + Intergenic
1082787119 11:57323412-57323434 ACCTGGTATGCAGAGCCCTGAGG + Intronic
1083545667 11:63547243-63547265 GCCTGGTCTCCACTGTGTTGGGG - Intergenic
1089966794 11:122659965-122659987 TGCTGGGCTGCACTGTGCTGTGG + Intronic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1097696238 12:62777408-62777430 ATCTGCTGGGCACTGTGCTGGGG - Intronic
1099343650 12:81471031-81471053 ACCTGGAAGACATTGTGCTGAGG - Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1104450564 12:128865145-128865167 ACCTGCTATCCTCTGCGCTGTGG + Intronic
1105253472 13:18722277-18722299 ACTTAGTATGGACTGTGCTGGGG - Intergenic
1105396664 13:20043210-20043232 CGCAGGTATCCACTGTGCTGGGG + Intronic
1106569509 13:30914428-30914450 AACTGGCATGCACTGTGATGAGG + Intronic
1106698558 13:32204821-32204843 ACATGCTAGGCACTGTGCTTGGG + Intronic
1107305745 13:39016798-39016820 ACCTGCTAGGCACTGTTCTCAGG + Intronic
1111341456 13:86891548-86891570 ATGTGGTAGGCACTGTTCTGAGG - Intergenic
1113476931 13:110590612-110590634 ACCTGCCAGGCATTGTGCTGAGG - Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114173431 14:20297289-20297311 ACATGGTCTGCACTGTCTTGTGG - Intronic
1114898637 14:27027336-27027358 CCCGGGTGTGCACTGTGCTAAGG - Intergenic
1115523164 14:34253148-34253170 ACATGGTATACTCTGAGCTGGGG - Intronic
1117245731 14:53884644-53884666 ACCTGGCATGTACTGTGGTAAGG + Intergenic
1121309275 14:92926394-92926416 ACATGGTAAGCACTGTGTTAAGG + Intronic
1121529657 14:94643595-94643617 AGCTGCAATGCTCTGTGCTGCGG + Intergenic
1125152731 15:36551687-36551709 AGCTGGAATTCACTGTGCTCGGG + Intergenic
1125910942 15:43438238-43438260 TCCTAATATGTACTGTGCTGTGG - Intronic
1128818321 15:70630153-70630175 CCCTGCTATGCACTGAGCAGCGG - Intergenic
1129276323 15:74448091-74448113 ACCAGGCAGGCACTGAGCTGGGG - Intronic
1130105387 15:80924941-80924963 ACCAGCTATTCACTTTGCTGAGG - Intronic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1136144332 16:28307063-28307085 ATCTGTACTGCACTGTGCTGGGG - Intronic
1136290169 16:29266966-29266988 ACCTGGTGGGCACAGTGTTGAGG - Intergenic
1136676077 16:31907409-31907431 ACCTGTTATCAAGTGTGCTGGGG + Intronic
1139513591 16:67440841-67440863 TCCTGGGATCCTCTGTGCTGGGG - Intronic
1139661815 16:68425929-68425951 ACATGGAATCCTCTGTGCTGGGG - Intronic
1142096053 16:88240488-88240510 ACCTGGTGGGCACAGTGTTGAGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1144129246 17:12229838-12229860 TGCTGGTGTGCACTGTGCTAGGG + Intergenic
1144391378 17:14796693-14796715 TCATGGTCTGCACTTTGCTGAGG + Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1148970721 17:51478891-51478913 AACTGGTATTGAGTGTGCTGGGG - Intergenic
1149540710 17:57466066-57466088 GCCTGGTGTGCACCGAGCTGGGG - Intronic
1150931147 17:69586807-69586829 TTCTGGTAGGCACTGTGCTAGGG + Intergenic
1151620661 17:75242983-75243005 ATGTGGTTTGCACTGTGCTGCGG - Intronic
1151769018 17:76147595-76147617 TCTTGGTATGCTCTGTGGTGAGG + Intronic
1152059955 17:78064917-78064939 ACCTGGTTTGCACAGGGCTGAGG - Exonic
1153940080 18:9969596-9969618 ACCTGTCATTCACTGTCCTGAGG + Intergenic
1156392558 18:36664573-36664595 ACCTGGGCTGTGCTGTGCTGTGG + Intronic
1156498250 18:37540272-37540294 ACCTGGGAGGCTCTGGGCTGGGG - Intronic
1156708838 18:39916970-39916992 TCCTGATATGCACTGACCTGTGG - Intergenic
1158224020 18:55182025-55182047 CCCTGGGTGGCACTGTGCTGGGG - Intergenic
1159533172 18:69681604-69681626 ACCAAGTATGCACTTTCCTGTGG - Intronic
1160169792 18:76543691-76543713 GCCTGGTGTCCACTGTGCAGAGG - Intergenic
1160403891 18:78631277-78631299 GCCTGGTGCGCACTGAGCTGAGG - Intergenic
1160546228 18:79657765-79657787 AGCTGGGATGCACGTTGCTGGGG - Intergenic
1161744058 19:6044157-6044179 CCCCGGTTTGCACGGTGCTGCGG + Intronic
1164737869 19:30555083-30555105 CTCTGGGTTGCACTGTGCTGGGG - Intronic
1167763164 19:51462040-51462062 CCCTGGTGTGGACAGTGCTGTGG - Intergenic
926730458 2:16032330-16032352 ACCTGGGAAGTGCTGTGCTGAGG + Intergenic
928368439 2:30721509-30721531 GGCTGGTCTGCCCTGTGCTGGGG + Intergenic
928613803 2:33016661-33016683 TCCTGGCCAGCACTGTGCTGTGG - Intronic
929913692 2:46115788-46115810 ACCTGGTACCCTCTGTGATGGGG - Intronic
932493865 2:72137144-72137166 ACCAGGTCTGCCATGTGCTGGGG - Intronic
934487810 2:94733375-94733397 ACTTAGCATGTACTGTGCTGGGG - Intergenic
935528314 2:104200379-104200401 GCATGGTAGGCACTGTTCTGTGG - Intergenic
938624681 2:133095332-133095354 AGCTGGTTTGCACAGTGATGGGG - Intronic
939954441 2:148514749-148514771 AGGTGGCATGCTCTGTGCTGTGG - Intronic
943288889 2:186042828-186042850 AGCTGAAAAGCACTGTGCTGGGG + Intergenic
943732807 2:191320968-191320990 CCCTAGAAAGCACTGTGCTGGGG - Intronic
944439363 2:199726936-199726958 AGATGGGATGCACTGTGCTGGGG + Intergenic
1170356135 20:15493707-15493729 ATCTGGTTTTCACTTTGCTGGGG - Intronic
1170769095 20:19316692-19316714 ACCTGAAATGGACTTTGCTGAGG + Intronic
1172872454 20:38144188-38144210 TCCAGGTGTGCACGGTGCTGGGG - Intronic
1173393275 20:42654298-42654320 TCCTTGAATGCACTGTGCTAGGG - Intronic
1173821753 20:46024112-46024134 GCCTGGAATGCTGTGTGCTGTGG + Intronic
1174581293 20:51573739-51573761 TCCTGGGCTGGACTGTGCTGAGG - Intergenic
1176109939 20:63406586-63406608 ACCTCGGAGGCACCGTGCTGAGG + Exonic
1176838977 21:13822215-13822237 ACTTAGTATGGGCTGTGCTGGGG - Intergenic
1176901329 21:14445755-14445777 TCCTGGTTTGCAGTGTTCTGTGG + Intergenic
1177083963 21:16678398-16678420 ACCTTGTGTGTACTGTGCTAAGG - Intergenic
1179049325 21:37875319-37875341 CCCCGCTAAGCACTGTGCTGGGG - Intronic
1181763866 22:25077300-25077322 ACCTTGGAGGAACTGTGCTGAGG + Intronic
1183457256 22:37929629-37929651 TCCAGGTATGCTGTGTGCTGTGG + Intronic
1184272282 22:43391519-43391541 ACCTGTGATGCTCTTTGCTGTGG + Intergenic
1184868250 22:47216075-47216097 ACCAGGTATCCACTGTGCTGCGG + Intergenic
1185419001 22:50724887-50724909 ACCTGGTAGGCCCAGGGCTGGGG + Intergenic
950188969 3:10963316-10963338 ACATGGAAGGCACTGAGCTGAGG + Intergenic
950676358 3:14556455-14556477 ACCTAGTATGAAATGTGTTGAGG - Intergenic
951613643 3:24519868-24519890 ACCCTCTAGGCACTGTGCTGAGG - Intergenic
952385674 3:32839907-32839929 AACTGGGAAGCACTTTGCTGAGG + Intronic
952723682 3:36559894-36559916 CCCTGCTTTGCACTGTGCTCAGG - Intergenic
953787016 3:45918837-45918859 ACCTGGAATCCAGTGTGTTGAGG + Exonic
961326000 3:126109787-126109809 ACCTGGGATGGACTGGGCTGTGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961808753 3:129508383-129508405 ACCTAGTAGGCAATGTACTGAGG + Intronic
962622630 3:137195102-137195124 ACCTGCTCTGCACTGCCCTGGGG + Intergenic
965246966 3:166285136-166285158 ACCTGGAAACCACTGTGCAGAGG + Intergenic
966240640 3:177752159-177752181 ACCTGATGTCAACTGTGCTGGGG - Intergenic
969582098 4:8071563-8071585 GCCTGGGATGCTCTGTGCTTGGG + Intronic
970434889 4:16023706-16023728 ACCTGGACTGCACTCTGGTGGGG + Intronic
975879834 4:78891368-78891390 ACCTTTTATTCATTGTGCTGGGG + Intronic
976953116 4:90858344-90858366 ACCTGGTACGCTCTGTCATGTGG - Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
982348602 4:154389401-154389423 CCCTGATATGCACTGGACTGAGG - Intronic
983566849 4:169162493-169162515 TTCTGGAAAGCACTGTGCTGGGG + Intronic
986604885 5:9512411-9512433 CCCTGCTATGCACTGAGCTCTGG - Intronic
990651661 5:57906912-57906934 CCCAGGGATGCGCTGTGCTGTGG - Intergenic
990735605 5:58858409-58858431 ACCTCATATGCTCAGTGCTGTGG + Exonic
990972563 5:61525068-61525090 CCCTGGCATACACTATGCTGGGG + Intronic
991158454 5:63466620-63466642 ACCTTATGTGCACTGTTCTGAGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
993843488 5:92909993-92910015 ACCTGCTATTGACTGTGCTGTGG - Intergenic
994219027 5:97173504-97173526 AAATGTTATGCACTGTGCTGGGG + Intronic
995772007 5:115680908-115680930 ACCTGCTTTGCATTGTTCTGTGG - Intergenic
997657901 5:135568861-135568883 CCCTGGTATGCACTGTCTTCTGG + Intergenic
1000262865 5:159605394-159605416 ATCTGTTAGACACTGTGCTGAGG - Intergenic
1001203750 5:169742889-169742911 ACCTGCAAGGCACTGTTCTGGGG - Intronic
1001396386 5:171421695-171421717 TCCTGATAGGCACTGAGCTGGGG + Intronic
1001914406 5:175547622-175547644 ACCTGGCTTGCATTTTGCTGAGG - Intergenic
1002808585 6:603193-603215 TCCTGGGATACATTGTGCTGTGG - Intronic
1002850663 6:993613-993635 GCATGGTATGCACTGAGATGTGG - Intergenic
1003052879 6:2795988-2796010 TTCTGGTATGAACTGTCCTGAGG - Intergenic
1003350575 6:5313933-5313955 AATTGGTATGTAGTGTGCTGGGG + Intronic
1007277901 6:40689134-40689156 CCCTGGTCCGCTCTGTGCTGTGG + Intergenic
1008600835 6:53092304-53092326 ACCTGGGAGGCACTGTTCTGAGG - Intronic
1009452136 6:63813705-63813727 CCCTGGTGTCCACTCTGCTGAGG - Intronic
1010682921 6:78817834-78817856 TCCTGGTATGCCATTTGCTGAGG - Intergenic
1011200942 6:84835474-84835496 CCCTGCTCTGCCCTGTGCTGAGG + Intergenic
1012628511 6:101433487-101433509 ACTTGCAATGCACTGAGCTGAGG - Intronic
1014199628 6:118594149-118594171 GCATGTTAAGCACTGTGCTGGGG - Intronic
1015150586 6:130032576-130032598 ATCTGGTAAGTACTATGCTGTGG + Intronic
1017722654 6:157254819-157254841 TCCTGGTCTGCCCTGGGCTGAGG + Intergenic
1017941501 6:159057256-159057278 AGCTGGTCTGCAGTGTTCTGCGG + Intergenic
1020372851 7:7453446-7453468 ACCAGGTAAGCCCTGTCCTGCGG + Exonic
1021056927 7:16060472-16060494 TCCTGGGTTGCAATGTGCTGGGG - Intergenic
1022548208 7:31209008-31209030 ACCTGGAAAGAGCTGTGCTGTGG + Intergenic
1024170964 7:46785961-46785983 ACAAGGTAGGCACTGTGCGGGGG + Intergenic
1028941044 7:96522418-96522440 AACTAGTAGGCACTGTTCTGAGG + Intronic
1032801823 7:135322914-135322936 ACCTGGTATCCCCAGTGCTGGGG + Intergenic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1035126304 7:156610319-156610341 ACCTGGTGTGCGCCTTGCTGGGG + Intergenic
1041627595 8:60048280-60048302 ACCTTCTATGCAGTGTGCTCAGG + Intergenic
1047315158 8:123726454-123726476 TCCTGCCATGCACTGAGCTGTGG + Intronic
1047764951 8:127982940-127982962 ACCTGTTGTGCACAGTGGTGGGG + Intergenic
1048893067 8:138965057-138965079 ACCTGGGAAGCTTTGTGCTGGGG - Intergenic
1049328184 8:142034912-142034934 CACTGGACTGCACTGTGCTGGGG - Intergenic
1050589771 9:7149306-7149328 TCCTGGTATGCACTCTGCAGTGG - Intergenic
1051010297 9:12404538-12404560 TCCTGGGATTCACTGTGCTCTGG + Intergenic
1053669989 9:40351041-40351063 ACTTAGCATGTACTGTGCTGGGG + Intergenic
1053919781 9:42977291-42977313 ACTTAGCATGTACTGTGCTGGGG + Intergenic
1054381115 9:64491040-64491062 ACTTAGCATGTACTGTGCTGGGG + Intergenic
1054514624 9:66025256-66025278 ACTTAGCATGTACTGTGCTGGGG - Intergenic
1055630676 9:78220326-78220348 AGCTGATATGAACTGTGCTGAGG - Intergenic
1059217217 9:112575231-112575253 ACCTGGTATGCACTGTGCTGTGG - Exonic
1060261062 9:122073922-122073944 GCCTTGGATGCTCTGTGCTGGGG - Intronic
1060821492 9:126664080-126664102 ACCTGGTATCCCCTGGGCTGGGG - Intronic
1061841278 9:133359787-133359809 ACCTGGTAGGAACAGAGCTGAGG + Intronic
1185469568 X:374288-374310 ACCTGGCGTGCCCTGTGCTCTGG - Intronic
1185586393 X:1244685-1244707 ACCTGGGACGCAGTGAGCTGTGG - Intergenic
1186362877 X:8861162-8861184 TTCTGGTGTGAACTGTGCTGTGG + Intergenic
1191871076 X:65745826-65745848 GCCTGGAATGCAAAGTGCTGTGG - Intergenic
1193473696 X:81937707-81937729 ACCTTGCATGCAATGTGCTTAGG - Intergenic
1195529281 X:105933504-105933526 ATGTGGTATGCCCTGTCCTGTGG - Intronic
1195593915 X:106666014-106666036 ACATGGTAGGCAATGAGCTGAGG - Intronic
1199822300 X:151461487-151461509 ACATGCTAGGCACTGTGCTGAGG - Intergenic