ID: 1059218087

View in Genome Browser
Species Human (GRCh38)
Location 9:112585516-112585538
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059218079_1059218087 11 Left 1059218079 9:112585482-112585504 CCACCTGTGAAAGGCTGTGCATG 0: 1
1: 0
2: 0
3: 29
4: 215
Right 1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG No data
1059218080_1059218087 8 Left 1059218080 9:112585485-112585507 CCTGTGAAAGGCTGTGCATGTGA 0: 1
1: 0
2: 3
3: 11
4: 176
Right 1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr