ID: 1059221155

View in Genome Browser
Species Human (GRCh38)
Location 9:112620287-112620309
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059221153_1059221155 10 Left 1059221153 9:112620254-112620276 CCTATTCTGTATAATCAGCAACA 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1059221155 9:112620287-112620309 CCAAATCTTGATTGTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr