ID: 1059225718

View in Genome Browser
Species Human (GRCh38)
Location 9:112671123-112671145
Sequence TGGGATCCCCTGAGAAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059225718_1059225724 14 Left 1059225718 9:112671123-112671145 CCTGTATTTCTCAGGGGATCCCA No data
Right 1059225724 9:112671160-112671182 AGAAATAAAAATTCCTGCTGGGG No data
1059225718_1059225722 12 Left 1059225718 9:112671123-112671145 CCTGTATTTCTCAGGGGATCCCA No data
Right 1059225722 9:112671158-112671180 TGAGAAATAAAAATTCCTGCTGG No data
1059225718_1059225723 13 Left 1059225718 9:112671123-112671145 CCTGTATTTCTCAGGGGATCCCA No data
Right 1059225723 9:112671159-112671181 GAGAAATAAAAATTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059225718 Original CRISPR TGGGATCCCCTGAGAAATAC AGG (reversed) Intergenic
No off target data available for this crispr