ID: 1059225722

View in Genome Browser
Species Human (GRCh38)
Location 9:112671158-112671180
Sequence TGAGAAATAAAAATTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059225721_1059225722 -8 Left 1059225721 9:112671143-112671165 CCAAAGAAATAAGGATGAGAAAT No data
Right 1059225722 9:112671158-112671180 TGAGAAATAAAAATTCCTGCTGG No data
1059225720_1059225722 -7 Left 1059225720 9:112671142-112671164 CCCAAAGAAATAAGGATGAGAAA No data
Right 1059225722 9:112671158-112671180 TGAGAAATAAAAATTCCTGCTGG No data
1059225718_1059225722 12 Left 1059225718 9:112671123-112671145 CCTGTATTTCTCAGGGGATCCCA No data
Right 1059225722 9:112671158-112671180 TGAGAAATAAAAATTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059225722 Original CRISPR TGAGAAATAAAAATTCCTGC TGG Intergenic
No off target data available for this crispr