ID: 1059225723

View in Genome Browser
Species Human (GRCh38)
Location 9:112671159-112671181
Sequence GAGAAATAAAAATTCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059225718_1059225723 13 Left 1059225718 9:112671123-112671145 CCTGTATTTCTCAGGGGATCCCA No data
Right 1059225723 9:112671159-112671181 GAGAAATAAAAATTCCTGCTGGG No data
1059225720_1059225723 -6 Left 1059225720 9:112671142-112671164 CCCAAAGAAATAAGGATGAGAAA No data
Right 1059225723 9:112671159-112671181 GAGAAATAAAAATTCCTGCTGGG No data
1059225721_1059225723 -7 Left 1059225721 9:112671143-112671165 CCAAAGAAATAAGGATGAGAAAT No data
Right 1059225723 9:112671159-112671181 GAGAAATAAAAATTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059225723 Original CRISPR GAGAAATAAAAATTCCTGCT GGG Intergenic
No off target data available for this crispr