ID: 1059228258

View in Genome Browser
Species Human (GRCh38)
Location 9:112693298-112693320
Sequence CTTTAGGCAGAAAGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059228258_1059228267 29 Left 1059228258 9:112693298-112693320 CCCTCCCCACTTTCTGCCTAAAG 0: 1
1: 0
2: 5
3: 45
4: 328
Right 1059228267 9:112693350-112693372 CAACTCTAGACTCTTAGCCTAGG No data
1059228258_1059228268 30 Left 1059228258 9:112693298-112693320 CCCTCCCCACTTTCTGCCTAAAG 0: 1
1: 0
2: 5
3: 45
4: 328
Right 1059228268 9:112693351-112693373 AACTCTAGACTCTTAGCCTAGGG No data
1059228258_1059228265 3 Left 1059228258 9:112693298-112693320 CCCTCCCCACTTTCTGCCTAAAG 0: 1
1: 0
2: 5
3: 45
4: 328
Right 1059228265 9:112693324-112693346 GGATAGAACTTCTCCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059228258 Original CRISPR CTTTAGGCAGAAAGTGGGGA GGG (reversed) Intronic
900628996 1:3624039-3624061 CTTCAGTCAGGGAGTGGGGATGG - Intergenic
901051078 1:6426202-6426224 CTGAAGGCAGAAGGTGGGGTTGG - Intronic
901838773 1:11940676-11940698 CTTTGGGCAGTAGGTGGGGAGGG + Intronic
902111274 1:14080464-14080486 CCTTAGGCAGAAAAGGGGGTGGG + Intergenic
902788816 1:18751147-18751169 CTGAAGGCAGCAAGTGGGGCTGG + Intergenic
903434972 1:23342665-23342687 CTTAAGGTAGTATGTGGGGATGG - Intronic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
905726634 1:40258017-40258039 CTTTGGGCCGGAAGTGAGGAAGG + Intergenic
906202360 1:43968211-43968233 CTTTGGGCTGCAAGTGGGGTAGG + Intergenic
907441409 1:54480723-54480745 CCATAGGCAGCATGTGGGGAGGG + Intergenic
909379487 1:74981946-74981968 ATTTAGGTAGAAAGGGAGGAAGG + Intergenic
909389050 1:75096701-75096723 CTTTAGGTATAAAGGGGAGAGGG - Intergenic
911519456 1:98911036-98911058 CATCAGGCAGAAAGGGAGGAAGG - Intronic
912138365 1:106689827-106689849 GGTTTGGCAGGAAGTGGGGAGGG + Intergenic
912517043 1:110223001-110223023 CTCCAGGCAGAAAGTGGTGATGG - Exonic
914327868 1:146638081-146638103 CTTCAGTTAGAAAGAGGGGAGGG + Intergenic
914876114 1:151513644-151513666 CTTCTGGCAGGAAGTGGGGGTGG - Intronic
915164345 1:153940324-153940346 CTTCAGGCACAAAGTGAGGGAGG - Intronic
916638485 1:166700183-166700205 CTCTAGGCAGAAAGTAGAGAAGG - Intergenic
916758467 1:167795803-167795825 CTTTAGGAAGGATGTGAGGAGGG - Intergenic
917167660 1:172130781-172130803 CAGTAGGCTGGAAGTGGGGAAGG + Intronic
918404887 1:184201976-184201998 ATTTAGGCACAAAGTTAGGAAGG + Intergenic
920516305 1:206586924-206586946 GTTTAGGCAGAAACTGGAGGAGG + Exonic
922989836 1:229897164-229897186 CTTTAGGCTGAGAGTGGGCTGGG + Intergenic
923245799 1:232130914-232130936 CTTTAGGCAAACAGTAGGGAAGG + Intergenic
1066997543 10:42577941-42577963 CATTAGGCAGTGAGTGGGCAGGG + Intronic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1069241481 10:66145505-66145527 ATTTATAGAGAAAGTGGGGAAGG + Intronic
1069565199 10:69459406-69459428 AATTAGGGAGCAAGTGGGGAGGG + Intronic
1069577100 10:69538478-69538500 CTGTAGCTAGTAAGTGGGGAAGG - Intergenic
1071199942 10:83209917-83209939 CTTCAGGCAGAAAAGGGGGAAGG + Intergenic
1071287403 10:84161796-84161818 CTTTAGGCTGAAACTTGGGCTGG + Intergenic
1072298927 10:94040332-94040354 ATTTAGGCAGAAAGGGAGGAGGG - Intronic
1073663126 10:105499423-105499445 TTTTATTCAGAAAGTGGGAATGG + Intergenic
1074872540 10:117588378-117588400 CTTGAGGCCGTCAGTGGGGATGG - Intergenic
1076799039 10:132812253-132812275 CTTTTGGCAGGAGGTGGGGATGG - Intronic
1077206009 11:1344766-1344788 CTCAAGGCAGAAACTGTGGATGG + Intergenic
1077908718 11:6556511-6556533 TTTTAGGGAGAATGTGGGGGAGG + Intronic
1078333473 11:10445126-10445148 ATTATGGCAGGAAGTGGGGAGGG - Intronic
1079135057 11:17771702-17771724 CTCCAGGCAGAAGGTGGTGATGG - Exonic
1079725025 11:23870040-23870062 CTACAGGCAGAAAGTAGAGAAGG + Intergenic
1080866044 11:36195991-36196013 ATTTTGGCAAAAAGTTGGGATGG - Intronic
1081983515 11:47285043-47285065 CGTCAGGCAGAAATTGGAGAGGG + Exonic
1082689183 11:56278852-56278874 CTTGAAGCAGGAGGTGGGGAGGG - Intergenic
1087102725 11:94380774-94380796 CTGGGGGCAGGAAGTGGGGAGGG + Intronic
1088544726 11:110947806-110947828 CTCTAAGAAGAGAGTGGGGAAGG + Intergenic
1088738081 11:112745103-112745125 CTTTAGGTACAAAGTAGGCATGG + Intergenic
1088834342 11:113565267-113565289 CTTCAGGGAGATACTGGGGAAGG + Intergenic
1088892515 11:114056395-114056417 TCTCAGGCAGAAATTGGGGAGGG - Intergenic
1088907113 11:114163218-114163240 CTTGAGGCAGAAAGCGAGAAGGG - Intronic
1088981744 11:114870732-114870754 CTTTAGGGAGAATGTGAGGTGGG - Intergenic
1089437319 11:118481221-118481243 GTTGAGGGGGAAAGTGGGGATGG - Intronic
1089820179 11:121218681-121218703 CTATAGCCAGAAACTGGGAAGGG - Intergenic
1090363757 11:126190031-126190053 TTTGATGCAGAAAGAGGGGAAGG - Intergenic
1090489726 11:127148086-127148108 CTTTAGGCAGTGAGTGTGAATGG + Intergenic
1091825643 12:3510727-3510749 CTGTAAGAAGAAAGTGGGGTGGG - Intronic
1091999579 12:5021238-5021260 CTTTGGGCAGACAGAGGGGAGGG - Intergenic
1092893506 12:12991467-12991489 CTCAATGCAGAAAGTGGTGATGG - Intronic
1092907327 12:13113637-13113659 CTTTATGCAGTAAGCAGGGAAGG - Intronic
1093596717 12:20971487-20971509 TGGTAGGCAGAAAGTGGGGGAGG - Intergenic
1093601704 12:21034251-21034273 GTTTGGGGGGAAAGTGGGGATGG - Intronic
1094100433 12:26756691-26756713 CTTCAGGCTGAAAGGGGTGATGG - Intronic
1094304545 12:29003241-29003263 CTTGAGGCAGAGTGTGGGAATGG + Intergenic
1094317065 12:29146484-29146506 CTTTAGGCAGACAGTAAGGAAGG - Intergenic
1094422823 12:30289863-30289885 CATGAGGCACAAAGTGGAGAGGG + Intergenic
1096354474 12:50928637-50928659 CTTTAGGCAGACAGTAGGGAAGG - Intronic
1096491113 12:52013602-52013624 CCTTAGCCAGAAAGGGGAGAAGG - Intronic
1097650518 12:62292404-62292426 CTCTAGGCAGAGAGTGGGACAGG + Intronic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1098046547 12:66407229-66407251 CTACAGGCAGGAGGTGGGGAGGG - Intronic
1098203196 12:68078973-68078995 CCTGAGGCAGAATGAGGGGAGGG + Intergenic
1098352545 12:69579195-69579217 CTTTTTGGAGGAAGTGGGGATGG + Exonic
1099664019 12:85602854-85602876 TTTTTGGCAGAAAATGGGGTGGG - Intergenic
1100958373 12:99935254-99935276 CTATAGCCACAAAGTTGGGAAGG + Intronic
1101058386 12:100944491-100944513 CTTTTGGGGGAAAGTGGGGAGGG - Intronic
1101234446 12:102774739-102774761 CCTTTGGGAGAAAGTTGGGATGG + Intergenic
1102586920 12:113930211-113930233 CTTGAGACAGAAAGAGGGAAGGG - Intronic
1103497912 12:121376979-121377001 GAATAGGCAGGAAGTGGGGAAGG + Intronic
1104412867 12:128573765-128573787 CTTGAGGCAGATGGTGGTGATGG + Intronic
1105553787 13:21426391-21426413 TTTGAGGAAGACAGTGGGGAGGG - Intronic
1107786493 13:43962997-43963019 CATTGGGCAGAGGGTGGGGAAGG - Intergenic
1110225158 13:73112009-73112031 CTTTAGATAGAAAGTGGGGGGGG - Intergenic
1110511746 13:76358939-76358961 ATGTAGGCAGAAAGTGGAAAAGG - Intergenic
1111795057 13:92908809-92908831 CTGTAGTCCGAAACTGGGGAGGG + Intergenic
1112537258 13:100271546-100271568 CCTTGGCCAGAAAATGGGGAAGG + Intronic
1112683844 13:101799689-101799711 CTTTGGGAAGGAAGTGGGAAGGG - Intronic
1113420748 13:110169996-110170018 CTTGAGACAGAAATTGAGGAAGG + Intronic
1114576456 14:23718965-23718987 CCTTAGGGTGAAAGTGGGAAAGG - Intergenic
1115358836 14:32478744-32478766 TTTTAGGCAGGAAATGGGGATGG + Intronic
1115798000 14:36960631-36960653 CTTTAGGCAGAAGGCGGGGCAGG - Intronic
1117033805 14:51705584-51705606 CTTGAGAAAGAAAGTGGGGAGGG + Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117158324 14:52962622-52962644 CTTTAGGCAGAAAAGGAGGTTGG - Intergenic
1118728088 14:68644595-68644617 CTTTAGGCAGAGATTCAGGAAGG - Intronic
1119012652 14:71011884-71011906 CTATAGCCAAAAAGTAGGGAGGG - Intronic
1119380312 14:74224208-74224230 CCTTGAGCAGAAGGTGGGGAGGG - Intergenic
1120228938 14:81821971-81821993 CTTTAGGCAGAAAACAGGGAGGG + Intergenic
1120746726 14:88159123-88159145 CCTGAGGCATGAAGTGGGGATGG - Intergenic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122123708 14:99568086-99568108 CTTTAGGCAGAGAGGCAGGAGGG + Intronic
1122448539 14:101784748-101784770 CTTTGGGCAGAAAGAAGGGTGGG + Intronic
1122940443 14:104978679-104978701 CTTTAGTCAGAAGCTGGGGTGGG + Intergenic
1123470263 15:20545789-20545811 CCTGAATCAGAAAGTGGGGAAGG + Intergenic
1123647792 15:22454911-22454933 CCTGAATCAGAAAGTGGGGAAGG - Intergenic
1123667211 15:22617292-22617314 CTTGAGGCAGCAGGAGGGGAGGG + Intergenic
1123730562 15:23140766-23140788 CCTGAATCAGAAAGTGGGGAAGG + Intergenic
1123748700 15:23338192-23338214 CCTGAATCAGAAAGTGGGGAAGG + Intergenic
1124281074 15:28362075-28362097 CCTGAATCAGAAAGTGGGGAAGG + Intergenic
1124301628 15:28549546-28549568 CCTGAATCAGAAAGTGGGGAAGG - Intergenic
1124321051 15:28711859-28711881 CTTGAGGCAGCAGGAGGGGAGGG + Intronic
1124376906 15:29134286-29134308 CTTTAGTCAGGAGGTGGGCATGG - Intronic
1124481446 15:30083496-30083518 CTTGAGGCAGCAGGAGGGGAGGG - Intronic
1124487901 15:30135592-30135614 CTTGAGGCAGCAGGAGGGGAGGG - Intronic
1124522149 15:30413698-30413720 CTTGAGGCAGCAGGAGGGGAGGG + Intronic
1124536516 15:30552520-30552542 CTTGAGGCAGCAGGAGGGGAGGG - Intronic
1124542990 15:30604569-30604591 CTTGAGGCAGCAGGAGGGGAGGG - Intronic
1124562950 15:30792012-30792034 CTTGAGGCAGCAGGAGGGGAGGG - Intergenic
1124755628 15:32402729-32402751 CTTGAGGCAGCAGGAGGGGAGGG + Intronic
1124762137 15:32455072-32455094 CTTGAGGCAGCAGGAGGGGAGGG + Intronic
1124776493 15:32593996-32594018 CTTGAGGCAGCAGGAGGGGAGGG - Intronic
1124960349 15:34389211-34389233 CTTGAGGCAGCAGGAGGGGAGGG + Intronic
1124976978 15:34535432-34535454 CTTGAGGCAGCAGGAGGGGAGGG + Intronic
1125186346 15:36935272-36935294 CTGTATGCAGAAGTTGGGGAGGG - Intronic
1125928788 15:43584840-43584862 CTTCAGGCAGCAAATGGGAAAGG + Exonic
1125941954 15:43684675-43684697 CTTCAGGCAGCAAATGGGAAAGG + Intergenic
1126095974 15:45091012-45091034 CTTGAGGCAGAAGTTGGGGCTGG + Intergenic
1128009900 15:64283001-64283023 CTTTGGGCAGAAGGGTGGGAGGG + Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1132420413 15:101661191-101661213 ATTTAGGATGACAGTGGGGAAGG - Intronic
1132433892 15:101781509-101781531 CTTGAGGCAGCAGGAGGGGAGGG + Intergenic
1132514663 16:360567-360589 CTCTGGGCAGAACCTGGGGAAGG + Intergenic
1134776343 16:16856920-16856942 ATTTAGGTAGAAAGTGTGGGTGG + Intergenic
1136022683 16:27449965-27449987 CCTTATCCAGACAGTGGGGAAGG + Exonic
1138488845 16:57364352-57364374 CTTTTGGCAGGGAGAGGGGAGGG - Exonic
1138756516 16:59492962-59492984 CTCGGGGCAGAGAGTGGGGAAGG + Intergenic
1140005692 16:71072856-71072878 CTTCAGTTAGAAAGAGGGGAGGG - Intronic
1140019981 16:71229725-71229747 CTATGGGCTGGAAGTGGGGAAGG + Intronic
1140447801 16:75045390-75045412 CCTTAGGCATAGAGAGGGGATGG + Intronic
1141161613 16:81632874-81632896 CTTTACCCAGAAGGTGGGGGTGG - Intronic
1142980164 17:3666984-3667006 CTTTAGGTAGAAGGGGGGCAGGG - Intronic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1144071202 17:11672640-11672662 CTATCAGCAGAAAGTGGGAAGGG - Intronic
1145392321 17:22465288-22465310 TTTTTGCCAGGAAGTGGGGATGG - Intergenic
1145782530 17:27572428-27572450 CTTTAGACAGAAGCTGGGGTGGG + Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147169107 17:38607702-38607724 CCTTAGGCACAAAGTGGGGGAGG - Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147411837 17:40258704-40258726 GTTTAGCCAGAAAGAGAGGAGGG + Intronic
1147469840 17:40648626-40648648 GTTTAAGCTGAAAGTGGGGACGG - Intergenic
1147619922 17:41859125-41859147 CTTTGGGCAGCCAGAGGGGATGG + Intronic
1150733863 17:67718657-67718679 CTTTAGGCTGAAATGGGGGCAGG - Intronic
1151640682 17:75390675-75390697 GTGTAGACAGAAAGTAGGGAAGG + Intronic
1151847051 17:76663922-76663944 CTTTAGGCAAAAAAGGGGAAGGG + Intergenic
1155291380 18:24345764-24345786 CTTTAGACAGTGAGTGAGGAAGG - Intronic
1156577566 18:38336145-38336167 CTTTATGCTGAAAGCGTGGAGGG + Intergenic
1157190901 18:45580820-45580842 TTTAAGGCAGACAGTGGGCAAGG + Intronic
1157977620 18:52343418-52343440 CTTTACCTAGAAAGTGGGAAAGG - Intronic
1158061313 18:53347153-53347175 CTTCTGGCACAAAGTGGTGAGGG + Intronic
1158449527 18:57551598-57551620 CTTTAGGAAGGTAATGGGGAAGG - Intronic
1159493944 18:69176144-69176166 AGTTGGGCAGAAAGTGGAGAAGG - Intergenic
1160239781 18:77114869-77114891 CTGCAGGGAGGAAGTGGGGAAGG + Intronic
1160828340 19:1091037-1091059 CTTGAGGCAGGAAATGGGGTTGG - Intronic
1160847184 19:1171748-1171770 CCTTAGGCAGCAAGTGGGTGGGG + Intronic
1161777834 19:6273380-6273402 GTGTGGGAAGAAAGTGGGGATGG + Intronic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1162621459 19:11847651-11847673 GTTTATGTATAAAGTGGGGAAGG - Intergenic
1162625242 19:11879921-11879943 GTTTATGTATAAAGTGGGGAAGG - Intronic
1165874113 19:38993562-38993584 TATTAGACAGGAAGTGGGGATGG + Intronic
1166702181 19:44888590-44888612 CATGAGGCAGGAGGTGGGGAAGG + Exonic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
925883904 2:8377839-8377861 CTTTAGGCAAAAAGTAGAAAAGG - Intergenic
929807058 2:45155514-45155536 TTTCTGGCAGAATGTGGGGAGGG - Intergenic
930234487 2:48875668-48875690 CTTTAGGTAGAGATGGGGGAAGG + Intergenic
931319237 2:61159902-61159924 CTGGAGGCAGACAGTGGTGATGG - Intronic
934582821 2:95459255-95459277 CTATAGGCAGAAAGAGGCAACGG - Intergenic
934596629 2:95617459-95617481 CTATAGGCAGAAAGAGGCAACGG + Intergenic
936651605 2:114433567-114433589 CTATGGGCATAGAGTGGGGAGGG + Intergenic
936826406 2:116587114-116587136 TTTTTGGAAGAGAGTGGGGAGGG + Intergenic
936938812 2:117861967-117861989 GTTGAGGCCCAAAGTGGGGAAGG - Intergenic
938387482 2:130877220-130877242 CATGGGGCAGAAAGTGGAGAGGG + Intronic
939004372 2:136768101-136768123 CTTTTGAGAGAAAGTAGGGAAGG + Intronic
939025168 2:137004007-137004029 CTTTAGGAAGCAACAGGGGAGGG - Intronic
939241652 2:139568654-139568676 GTTTGGGGGGAAAGTGGGGATGG + Intergenic
940716679 2:157233769-157233791 CTGTAGGCACAAAGTGATGATGG - Intergenic
942216692 2:173727909-173727931 CTTTAGGCAGCAAGAGGAAAAGG + Intergenic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
945008945 2:205441347-205441369 CTTTTGGCAGGAGGTGGGGTTGG - Intronic
945836274 2:214839178-214839200 CTTTAGGCAGGAAAGGGGGAGGG + Intergenic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
947612572 2:231532994-231533016 CTGTAGGCAGTAAGTGGGGTGGG - Intergenic
947885546 2:233566670-233566692 CTTTAGGCAGTAAGTGCGGCTGG - Intronic
948031284 2:234819669-234819691 CTGTAGGCAGCATGTGGGAAGGG - Intergenic
949003098 2:241628568-241628590 CTTTAGGGAGGAAGTGGCGGTGG - Intronic
1168939019 20:1693438-1693460 CATTAGGCAGAAAGAGTTGAAGG + Intergenic
1169536660 20:6551308-6551330 TTTCAGGCAGAAAGGGCGGATGG - Intergenic
1169874732 20:10284497-10284519 CTTTAGGCAGAATGAGGAAATGG - Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1174933099 20:54836993-54837015 CTTGAAGGAGAAAGTGGGGAGGG + Intergenic
1177387992 21:20432711-20432733 AATTAAGAAGAAAGTGGGGAGGG + Intergenic
1178246420 21:30957250-30957272 ATGTAGGCAGGAGGTGGGGAGGG + Intergenic
1178623769 21:34198919-34198941 CTGTAGGCAGGATGTGGGCAGGG - Intergenic
1178835135 21:36090889-36090911 ATTTGAGGAGAAAGTGGGGATGG + Intergenic
1179458034 21:41513107-41513129 CTTTAGTCATAAAGTGGGGCCGG - Intronic
1180590415 22:16932500-16932522 CTGAAGGCAGAAAGTGAGGCAGG + Intergenic
1180657668 22:17436880-17436902 CTTTAGGCAGGAACTGGGGGTGG + Intronic
1181042951 22:20201465-20201487 GTTTAGGCAGAAAGGGAGGAAGG - Intergenic
1181806235 22:25375992-25376014 CTGCAGGCAGAAGGTGGTGAAGG - Intronic
1182570665 22:31235268-31235290 CTATAGGAAGGATGTGGGGAAGG - Intronic
1184344909 22:43907357-43907379 CTGTAGGAAGAAAGAGGGGAGGG - Intergenic
1184416381 22:44354179-44354201 GGATAGGGAGAAAGTGGGGAGGG - Intergenic
1184694413 22:46131582-46131604 CTCTAGGCAGGCAGAGGGGAGGG + Intergenic
1184927409 22:47652909-47652931 CTGAAGGAAGGAAGTGGGGATGG + Intergenic
1185391674 22:50564847-50564869 CTTTAGCCAGAGGGTGTGGAGGG + Intergenic
950162531 3:10771219-10771241 CCTACTGCAGAAAGTGGGGAGGG + Intergenic
950972290 3:17201435-17201457 CTTGGGGCAGAAAGCTGGGAGGG + Intronic
955396002 3:58557938-58557960 CTCTAGGCAGATAAGGGGGAGGG + Intergenic
955719735 3:61868075-61868097 TTTAAGGGAGAATGTGGGGAGGG - Intronic
956881868 3:73519179-73519201 CCTTGGGCAGAAAGTAGGGTGGG + Intronic
959892288 3:111570402-111570424 CATGAGGCAGGAGGTGGGGAAGG - Intronic
959933217 3:112004339-112004361 CTGTGGACAGAAAGTGGGAAAGG + Intronic
960729504 3:120710634-120710656 TTTAAGCAAGAAAGTGGGGATGG - Intronic
961256861 3:125562097-125562119 CTTTGGGGAGAAAGTGGGATTGG - Intronic
962375036 3:134852175-134852197 ATTGAGGCAGACAGTGGTGAGGG - Intronic
964339262 3:155690977-155690999 CCTTAGGCTGAGTGTGGGGAGGG - Intronic
964460491 3:156920037-156920059 CTTATGGCAGAAAGTGGAAAGGG - Intronic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
965483662 3:169251375-169251397 CTTTAGAAAGAAAGTTGGCAAGG + Intronic
967805482 3:193711416-193711438 CTGGAGGCAGAAAGAGGGCAGGG + Intergenic
967839329 3:193992173-193992195 ATTTAGGGGGAACGTGGGGAAGG - Intergenic
968597646 4:1493566-1493588 CTCCTGGCAGATAGTGGGGAGGG - Intergenic
968932991 4:3593101-3593123 CATTGCGCAGAGAGTGGGGATGG + Intergenic
969209158 4:5673052-5673074 CTGTAAGCAGACAGTGGTGATGG + Intronic
969359563 4:6653953-6653975 CTTGAGGCAGATGGTGGTGATGG + Intergenic
969719066 4:8883094-8883116 CCTCAGGCAGAGAGTGGAGAGGG + Intergenic
971376370 4:26058921-26058943 CAGCAGGCAGAAAGTTGGGATGG - Intergenic
972364303 4:38359976-38359998 CAATAGGCACAGAGTGGGGATGG - Intergenic
975581447 4:75910489-75910511 TTTCAGGAAGAAAATGGGGAGGG + Intergenic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
978577719 4:110202798-110202820 CTTCAGGCTGAGAGTGGGCAGGG + Intergenic
978661415 4:111131472-111131494 CTCTTGGGGGAAAGTGGGGATGG - Intergenic
979435269 4:120680783-120680805 CTTTGGGGACACAGTGGGGAAGG + Intergenic
981032186 4:140136498-140136520 ATTATGGCACAAAGTGGGGAGGG - Intronic
981454724 4:144940269-144940291 ATCTAGGCAGAAAGTGGTGGTGG - Intergenic
982136072 4:152275569-152275591 CTGTTGGGAGCAAGTGGGGAGGG - Intergenic
982367105 4:154591107-154591129 CTTTATGCAGAAATTAGGGTTGG + Intergenic
984434287 4:179688761-179688783 CTTTAGCCAGAAAATCAGGAGGG + Intergenic
984548270 4:181132190-181132212 CTAAAAGCAGAAACTGGGGAGGG + Intergenic
984998791 4:185464349-185464371 CTTCAGTCAGAGGGTGGGGAGGG + Intronic
988682157 5:33494154-33494176 CCTGAGGCAGAAAGTCAGGAGGG + Intergenic
989779761 5:45249939-45249961 CTGCAGGGGGAAAGTGGGGATGG - Intergenic
989795535 5:45466785-45466807 CTTTAGGTACAAAGTGTAGAAGG + Intronic
992201676 5:74390810-74390832 CTTTAGGGTGAAATTGTGGAGGG + Intergenic
995391732 5:111647378-111647400 CTTTATGCAGAAAGTGTGAATGG - Intergenic
996347489 5:122502633-122502655 CATTAGGCAGAAAATAGTGAGGG - Intergenic
996432577 5:123398082-123398104 CTTAGGGGAAAAAGTGGGGAGGG + Intronic
996710703 5:126540581-126540603 CTTTAGTCTGCAAGTGGAGATGG - Intergenic
997074097 5:130651664-130651686 CATTACTCAGCAAGTGGGGAGGG + Intergenic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
997602168 5:135148086-135148108 CTCAAGGCAGAATATGGGGAAGG - Intronic
997711365 5:136007448-136007470 CTTTAGGGAGAAAGAAGGGCAGG + Intergenic
997951565 5:138246585-138246607 TATTAGGCAGAAATTGGGGGAGG - Intergenic
998132600 5:139658978-139659000 CCTGAGGCAGAAAGTGTGGTGGG + Intronic
998142412 5:139707614-139707636 CTTCAGGCAGGCAGTGGGGGAGG + Intergenic
998173767 5:139887595-139887617 CTTTGGGCTGGAACTGGGGAAGG + Intronic
998540509 5:142977136-142977158 TTTTAGTTAGAAAGTGGGGATGG + Intronic
999855862 5:155593109-155593131 GTTTAGGCAGAGACTGGGGTTGG - Intergenic
1000497073 5:161997604-161997626 GTTTAGAGGGAAAGTGGGGATGG + Intergenic
1001088860 5:168722162-168722184 CTTTGGGCAGAGAGTGGGGAAGG + Intronic
1003313156 6:4986808-4986830 CTTAATGAAGAAAGTGGGGTGGG + Intergenic
1003503751 6:6723738-6723760 ATGGAGGCAGAAAGTGGAGAAGG - Intergenic
1004066085 6:12245794-12245816 ATTTAGGCAGAAAGTGTTGAAGG + Intergenic
1004084400 6:12430610-12430632 TTTTAGGCAGATTGTGGAGATGG - Intergenic
1004183959 6:13406102-13406124 CTTTTGGCAGGAGGTGGAGATGG + Intronic
1004650416 6:17602024-17602046 TTCTAGGGGGAAAGTGGGGAGGG + Intronic
1004883916 6:20034095-20034117 ATTGAAGGAGAAAGTGGGGAGGG + Intergenic
1005997469 6:30940116-30940138 CTTTAGGCAGGAAGTGAGGAAGG + Intergenic
1006795947 6:36732405-36732427 TTTTAGGGAGAATGTGGGGGGGG + Exonic
1009879814 6:69552987-69553009 ATTTAGGCAAAAAGTGATGATGG - Intergenic
1010180907 6:73085584-73085606 GTGTAGGGAGAAAGTGGGCAGGG + Intronic
1012852724 6:104466393-104466415 ATGAAGGCAAAAAGTGGGGAGGG - Intergenic
1013342117 6:109225114-109225136 CTTTTGACAGGAAGTGAGGAAGG - Intergenic
1015419750 6:132993313-132993335 CATTAGGCAGAAAGTGGTAATGG - Intergenic
1015702072 6:136047483-136047505 CCCTAGAAAGAAAGTGGGGAGGG + Intronic
1016168537 6:140978374-140978396 CTTTAGGAAGAAAATTTGGAGGG - Intergenic
1017985009 6:159436017-159436039 TTTCTGGCAGAAAGTGGGGTTGG - Intergenic
1019764148 7:2837190-2837212 CACGAGGCAGAAAGAGGGGATGG + Intronic
1021743334 7:23710726-23710748 CTGTTTGCAGAAAGTGGGTACGG + Intronic
1022300773 7:29100216-29100238 GTTTAGGAAGGAAGTGGGGCTGG - Intronic
1022374760 7:29802969-29802991 CTCCTGTCAGAAAGTGGGGAAGG - Intergenic
1023665040 7:42514144-42514166 CTTTAAGCAGGGAGTGGGTAAGG + Intergenic
1024999756 7:55305871-55305893 TAATAGGCAAAAAGTGGGGAAGG + Intergenic
1026254244 7:68697026-68697048 CAATAGGCAGAGAGTAGGGATGG + Intergenic
1028121045 7:87057261-87057283 TTTTAAGAGGAAAGTGGGGAGGG - Intronic
1028982938 7:96987110-96987132 GTTTAGGGAGAAAGAGGGCAAGG - Intergenic
1029065639 7:97845148-97845170 CTTCAGCCATAAAATGGGGATGG + Intergenic
1029107101 7:98186712-98186734 TTCTGGGCAGAAAGTGGGTAAGG - Intronic
1029340749 7:99942118-99942140 CTTTAGAGATAAAGTGGGGAAGG - Intergenic
1030407187 7:109129318-109129340 TTTTAGGCAGATAGAGGGAAAGG - Intergenic
1030887368 7:114954912-114954934 ATAGAGGCAGAAAGTGGTGAGGG - Intronic
1032636451 7:133714255-133714277 AGTTAGTCAGAAGGTGGGGAGGG - Intronic
1034188580 7:149196893-149196915 CTTGAGTCAGAGAGTGGGGCTGG + Intronic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1035041495 7:155931503-155931525 CTTGGGTCAGAAAATGGGGAAGG - Intergenic
1037228813 8:16629128-16629150 GTTGGGGGAGAAAGTGGGGATGG + Intergenic
1037920549 8:22802405-22802427 CTTTGGGCAGAAACTGGAGAAGG - Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038626923 8:29203005-29203027 CTTTATGTAGGAATTGGGGAAGG - Intronic
1038889513 8:31703925-31703947 TTTTAGGCAAAATGTGTGGAGGG - Intronic
1038975963 8:32696397-32696419 GCAAAGGCAGAAAGTGGGGAGGG - Intronic
1039064198 8:33595125-33595147 ATTCAGGCAGAAAGAGGAGATGG + Intronic
1041639037 8:60177056-60177078 TTTCAGGCAGAAACTGTGGAAGG + Intergenic
1042307499 8:67346695-67346717 TTTTGGGCAGACAGTGGGGCTGG - Intergenic
1042329617 8:67564664-67564686 CTTTAGGCAGAAATAGTGGCTGG - Intronic
1042913934 8:73856295-73856317 TTAAAGGTAGAAAGTGGGGAGGG - Intronic
1043476517 8:80610843-80610865 CTTAAAGCAGAAAGAGGAGAGGG - Intergenic
1044747869 8:95388719-95388741 CTTTAAGCAGAAAGTAGGAGGGG - Intergenic
1046152708 8:110249320-110249342 ATTTAGGGGGAAAGTGGGGAAGG + Intergenic
1046204167 8:110968481-110968503 CGGGAGGGAGAAAGTGGGGATGG - Intergenic
1047520261 8:125590598-125590620 CTTTAGCCTTAGAGTGGGGATGG - Intergenic
1047695014 8:127394898-127394920 GTTTTGGCAGTAGGTGGGGAAGG - Intergenic
1049291441 8:141805065-141805087 CTAAAGGCGGAAGGTGGGGATGG - Intergenic
1049533188 8:143166665-143166687 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533262 8:143166935-143166957 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533291 8:143167037-143167059 GTCTAGGGAGAAAGTGGGGAGGG + Intergenic
1049533321 8:143167139-143167161 GTCTAGGGAGAAAGTGGGGAGGG + Intergenic
1049533357 8:143167274-143167296 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533368 8:143167308-143167330 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533379 8:143167342-143167364 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533390 8:143167376-143167398 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533412 8:143167444-143167466 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533422 8:143167478-143167500 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533441 8:143167546-143167568 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533452 8:143167580-143167602 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533462 8:143167614-143167636 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533492 8:143167716-143167738 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533502 8:143167750-143167772 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533512 8:143167784-143167806 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533523 8:143167818-143167840 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533533 8:143167852-143167874 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533552 8:143167920-143167942 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533563 8:143167954-143167976 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533582 8:143168022-143168044 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533604 8:143168090-143168112 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533625 8:143168158-143168180 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533647 8:143168226-143168248 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533666 8:143168294-143168316 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533715 8:143168465-143168487 GTCTAGGGAGAAAGTGGGGAGGG + Intergenic
1050330943 9:4545576-4545598 CTTTGAGTAGAAAGTGGGTAAGG - Intronic
1052876290 9:33568707-33568729 CTTTATGGAGAAAGAGCGGATGG + Exonic
1054152683 9:61618045-61618067 GTCTAGGGAGAAAGTGGGAAGGG + Intergenic
1054180901 9:61908796-61908818 GTCTAGGGAGAAAGTGGGAAGGG - Intergenic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1054472462 9:65549193-65549215 GTCTAGGGAGAAAGTGGGAAGGG + Intergenic
1054656690 9:67672346-67672368 GTCTAGGGAGAAAGTGGGAAGGG + Intergenic
1055498016 9:76875155-76875177 CTCTGGGCAGACAATGGGGAAGG - Intronic
1055604185 9:77950592-77950614 CTCTAGGGAGGAAATGGGGAAGG + Intronic
1057259472 9:93576124-93576146 CTTGAGACTGAAAGTGGGGTGGG - Intergenic
1059011975 9:110470919-110470941 ATTAAGACAGTAAGTGGGGAGGG - Intronic
1059228258 9:112693298-112693320 CTTTAGGCAGAAAGTGGGGAGGG - Intronic
1061168601 9:128939028-128939050 ACTCAGGCAGAGAGTGGGGATGG - Intronic
1061842831 9:133369650-133369672 CATGAGGCAGAACCTGGGGAGGG - Intronic
1203737499 Un_GL000216v2:150634-150656 CTGTAGGCAGAGAGTGGAAAAGG + Intergenic
1186688952 X:11954568-11954590 CTTTAGGTAGGAAGTAAGGAGGG + Intergenic
1188459237 X:30404279-30404301 CTTTTTACAGAATGTGGGGAGGG + Intergenic
1189468870 X:41298793-41298815 CTTGAGACAGAAGGTGGGGTAGG + Intergenic
1190862925 X:54360564-54360586 CTGTAGGCAGAAAGGGGAGCGGG + Intergenic
1191735896 X:64387551-64387573 CTTTGAGTAGAAAGAGGGGAGGG - Intronic
1192340571 X:70260095-70260117 CTGTAGGCAGGCAGTGGGGAAGG - Intergenic
1192442313 X:71183592-71183614 CTGGAAGCAGAAACTGGGGAGGG - Intergenic
1193567882 X:83101114-83101136 TTTAAGGCTGGAAGTGGGGAAGG + Intergenic
1195094295 X:101490555-101490577 CTTAAGGCAGAAGTTGGGGAAGG + Exonic
1195250760 X:103044349-103044371 GTTTGGGAAGGAAGTGGGGATGG - Intergenic
1195386561 X:104318991-104319013 CTTTTGGGAGACAGTGGGGAGGG + Intergenic
1195751729 X:108166110-108166132 CTTTGGCCAAAAAGGGGGGAGGG - Intronic
1195900523 X:109792891-109792913 CTTGGGGGAGAAAGTGGGGAAGG - Intergenic
1199086565 X:143635316-143635338 TTTTAGGCAAAAAGAGGGGGCGG - Intronic
1199216329 X:145263640-145263662 CTTTGGCCAGTAAGTGGGCATGG - Intergenic
1202366407 Y:24168673-24168695 CTTGGGGCAGCAAGAGGGGAGGG - Intergenic
1202504375 Y:25501450-25501472 CTTGGGGCAGCAAGAGGGGAGGG + Intergenic