ID: 1059228258

View in Genome Browser
Species Human (GRCh38)
Location 9:112693298-112693320
Sequence CTTTAGGCAGAAAGTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059228258_1059228268 30 Left 1059228258 9:112693298-112693320 CCCTCCCCACTTTCTGCCTAAAG No data
Right 1059228268 9:112693351-112693373 AACTCTAGACTCTTAGCCTAGGG No data
1059228258_1059228267 29 Left 1059228258 9:112693298-112693320 CCCTCCCCACTTTCTGCCTAAAG No data
Right 1059228267 9:112693350-112693372 CAACTCTAGACTCTTAGCCTAGG No data
1059228258_1059228265 3 Left 1059228258 9:112693298-112693320 CCCTCCCCACTTTCTGCCTAAAG No data
Right 1059228265 9:112693324-112693346 GGATAGAACTTCTCCTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059228258 Original CRISPR CTTTAGGCAGAAAGTGGGGA GGG (reversed) Intronic