ID: 1059228259

View in Genome Browser
Species Human (GRCh38)
Location 9:112693299-112693321
Sequence TCTTTAGGCAGAAAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059228259_1059228265 2 Left 1059228259 9:112693299-112693321 CCTCCCCACTTTCTGCCTAAAGA 0: 1
1: 1
2: 4
3: 26
4: 241
Right 1059228265 9:112693324-112693346 GGATAGAACTTCTCCTCTACTGG No data
1059228259_1059228267 28 Left 1059228259 9:112693299-112693321 CCTCCCCACTTTCTGCCTAAAGA 0: 1
1: 1
2: 4
3: 26
4: 241
Right 1059228267 9:112693350-112693372 CAACTCTAGACTCTTAGCCTAGG No data
1059228259_1059228268 29 Left 1059228259 9:112693299-112693321 CCTCCCCACTTTCTGCCTAAAGA 0: 1
1: 1
2: 4
3: 26
4: 241
Right 1059228268 9:112693351-112693373 AACTCTAGACTCTTAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059228259 Original CRISPR TCTTTAGGCAGAAAGTGGGG AGG (reversed) Intronic
900540328 1:3199505-3199527 TCTCTAGGCAGAAAGAAGGGAGG + Intronic
900951360 1:5859860-5859882 TCTGTGGGCAGACAGTAGGGTGG - Intergenic
901674853 1:10877157-10877179 TCTTGAGGCAGAAGGAGGAGGGG + Intergenic
901838772 1:11940675-11940697 ACTTTGGGCAGTAGGTGGGGAGG + Intronic
902111272 1:14080463-14080485 CCCTTAGGCAGAAAAGGGGGTGG + Intergenic
905755441 1:40505476-40505498 TCTTTAGGCTGAAAGTTTTGGGG + Intergenic
906450534 1:45942858-45942880 CTTTTAGGCAGAAAGGGGGAAGG + Intronic
906864070 1:49396933-49396955 TTTTTCCGCAGACAGTGGGGTGG + Intronic
909389051 1:75096702-75096724 TCTTTAGGTATAAAGGGGAGAGG - Intergenic
909477121 1:76093640-76093662 TCTTCAGGCAGAAAATGGGGAGG - Intronic
914327867 1:146638080-146638102 TCTTCAGTTAGAAAGAGGGGAGG + Intergenic
914909880 1:151776261-151776283 TCTTCAGGCTGTATGTGGGGAGG + Exonic
916595112 1:166235719-166235741 TCTTAAAGCACAATGTGGGGAGG + Intergenic
919420348 1:197363292-197363314 TCTTGAGGCCTAAGGTGGGGAGG - Intronic
920184997 1:204153911-204153933 TCTTTTGACAGAAAGTCGTGAGG - Intergenic
920453635 1:206080454-206080476 ACTTTATGCACAGAGTGGGGAGG + Intronic
920939525 1:210468539-210468561 TCTTTAGGCTGAGAATGAGGAGG + Intronic
922578602 1:226680358-226680380 CCTTTTGGCAGAGAGGGGGGAGG + Intronic
922989835 1:229897163-229897185 GCTTTAGGCTGAGAGTGGGCTGG + Intergenic
923378873 1:233394420-233394442 TCTGTAGGCAGCAGATGGGGTGG - Intergenic
923404081 1:233643287-233643309 ACTTTGAGCAGAGAGTGGGGAGG + Intronic
923763029 1:236864518-236864540 TCTTTAGACAGTAAGTGAGCAGG - Intronic
924479319 1:244413475-244413497 TCCCTAGGCAGAAAGTTGGGTGG - Intronic
924615092 1:245605979-245606001 TCTTTGGACATAAAGTGGGATGG - Intronic
1062857582 10:786975-786997 TGGTTCTGCAGAAAGTGGGGAGG - Intergenic
1063070367 10:2656885-2656907 TCTTCAGACAGAAAGGGGAGGGG - Intergenic
1063411644 10:5840856-5840878 TCCTGCTGCAGAAAGTGGGGAGG + Intronic
1066997542 10:42577940-42577962 TCATTAGGCAGTGAGTGGGCAGG + Intronic
1068504587 10:57883759-57883781 TCTTGCGGCAGAAAATGGGAAGG - Intergenic
1069715909 10:70521183-70521205 TCGTCAGGCAGAGAGTGGAGTGG + Intronic
1070471854 10:76788342-76788364 TCTTTAGGAGGAAATTGGAGAGG - Intergenic
1071775862 10:88787114-88787136 TCTCTAGGAAGAAAGTGGCAAGG - Intergenic
1072298928 10:94040333-94040355 CATTTAGGCAGAAAGGGAGGAGG - Intronic
1074736713 10:116442343-116442365 TCCTTACTCATAAAGTGGGGTGG + Intronic
1076090330 10:127680126-127680148 CCTTTAAGCAAATAGTGGGGAGG - Intergenic
1077714295 11:4566294-4566316 TTTTTAGGCAGAAAGTGGGGAGG - Intergenic
1078704981 11:13734750-13734772 TATTGAGTCAGAAACTGGGGTGG + Intergenic
1079641179 11:22807546-22807568 TCTGTAGGCAGTAACTGGAGAGG - Intronic
1081376217 11:42361748-42361770 AAGTTAGGCAGAAAATGGGGTGG - Intergenic
1081504276 11:43698520-43698542 TCTTTGGGCAGAAAGTATAGTGG + Intronic
1082814374 11:57498661-57498683 TGATTAGGCAGAAACTGGGCTGG - Intronic
1086587875 11:88476904-88476926 ACTTTAGGTAGGAAGAGGGGAGG + Intergenic
1088907114 11:114163219-114163241 TCTTGAGGCAGAAAGCGAGAAGG - Intronic
1088981745 11:114870733-114870755 GCTTTAGGGAGAATGTGAGGTGG - Intergenic
1089427633 11:118393101-118393123 TCTTAAGGCAGGAAGAGGTGAGG - Intronic
1090341251 11:126022660-126022682 TCTTTTGGCTGAATCTGGGGTGG + Intronic
1090561500 11:127937796-127937818 TCTATAGAGAGACAGTGGGGAGG + Intergenic
1091449473 12:563376-563398 TCTTAAGGCAGATGGTGTGGAGG - Exonic
1091599831 12:1911500-1911522 TCTGTAGGCTGAGAGTGGGGAGG - Intronic
1091825644 12:3510728-3510750 GCTGTAAGAAGAAAGTGGGGTGG - Intronic
1091861474 12:3788874-3788896 TCTTGAGAAAGAAAGTTGGGGGG - Intergenic
1091999580 12:5021239-5021261 GCTTTGGGCAGACAGAGGGGAGG - Intergenic
1092981498 12:13799312-13799334 TGTTTTGGCAGAAGGTGGAGAGG + Intronic
1094248172 12:28327145-28327167 TATTTAGGCAGATAGAGGGAGGG + Intronic
1095248484 12:39950338-39950360 TCAATAGGCAGGGAGTGGGGAGG + Intronic
1095767300 12:45911116-45911138 TCTTTAGGTAGAAAATGGCATGG + Intergenic
1096530554 12:52239906-52239928 GCCTTAGGCAGAAGGTAGGGTGG + Intronic
1096979056 12:55718073-55718095 CCTCTAAGCTGAAAGTGGGGTGG - Intronic
1097765503 12:63522030-63522052 TCTCTAGGCAGAAAGAGAAGAGG + Intergenic
1098220669 12:68266798-68266820 TATTCAAGCAGAACGTGGGGAGG + Intergenic
1098338597 12:69428560-69428582 TCTTCAGGCAGAAAGCCCGGGGG - Intergenic
1098866862 12:75773043-75773065 CCTTTAGGCAGAAAGGGGGAGGG + Intergenic
1099664020 12:85602855-85602877 ATTTTTGGCAGAAAATGGGGTGG - Intergenic
1100034772 12:90236898-90236920 TCAACAGGCAGAAAGTGGGAGGG - Intergenic
1100251547 12:92829996-92830018 TTTTTAGGGAGAGTGTGGGGGGG + Intronic
1100405081 12:94265852-94265874 TCTTTAGGAAGAGCATGGGGTGG - Intronic
1101058387 12:100944492-100944514 ACTTTTGGGGGAAAGTGGGGAGG - Intronic
1102658895 12:114507709-114507731 TCTTTAGGCCTAATGTTGGGGGG + Intergenic
1105236231 13:18555902-18555924 TCTTGAGGCAGAGATTGGGGGGG - Intergenic
1106741995 13:32654361-32654383 TGTTTAGGCAGTAATTGGTGAGG + Intronic
1107782951 13:43924614-43924636 ACTTAAGGCAGAAAGTGAAGGGG + Intergenic
1110225159 13:73112010-73112032 ACTTTAGATAGAAAGTGGGGGGG - Intergenic
1111795056 13:92908808-92908830 TCTGTAGTCCGAAACTGGGGAGG + Intergenic
1112809158 13:103197603-103197625 TATTTATGAAGAAAGTGGTGAGG - Intergenic
1113048688 13:106184842-106184864 TCTTTAGGCAGGAAAGGGAGAGG - Intergenic
1113055242 13:106260382-106260404 TCTCTAGGCAAAGAGTTGGGAGG - Intergenic
1113332730 13:109346135-109346157 TCTTAAAGGAGAAAGTTGGGGGG + Intergenic
1114885807 14:26849641-26849663 TGTCTGGGCAGAAAGTGGGGAGG - Intergenic
1115776813 14:36724379-36724401 TCAGCAGGCAGGAAGTGGGGTGG + Intronic
1117033804 14:51705583-51705605 CCTTGAGAAAGAAAGTGGGGAGG + Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1117981856 14:61349538-61349560 TCTTTTGGTAGGAAATGGGGAGG + Intronic
1120228937 14:81821970-81821992 GCTTTAGGCAGAAAACAGGGAGG + Intergenic
1121010597 14:90517947-90517969 TGTTTAGGGAGACAGTGGGCGGG + Intergenic
1121523431 14:94601966-94601988 TCTCTAGGCAGTAAGGGGTGGGG + Intronic
1122135047 14:99627961-99627983 TCTTTAGGCAGTGGGAGGGGCGG + Intergenic
1122448538 14:101784747-101784769 TCTTTGGGCAGAAAGAAGGGTGG + Intronic
1122940442 14:104978678-104978700 ACTTTAGTCAGAAGCTGGGGTGG + Intergenic
1122980456 14:105189960-105189982 TATAAAGACAGAAAGTGGGGTGG + Intergenic
1124466157 15:29941591-29941613 TTGTTGGGCAAAAAGTGGGGAGG - Intronic
1125508509 15:40281014-40281036 TCAGTAGGCAGAAAGTGGGGAGG + Intronic
1128432854 15:67615351-67615373 TTTTTAGGCAGAAAGAAGGTTGG + Intronic
1128546345 15:68571007-68571029 TCTTTTGGAAGAAAGTGCGAAGG + Intergenic
1129275480 15:74442655-74442677 TCTGGGGGCTGAAAGTGGGGAGG - Intergenic
1131467815 15:92669493-92669515 TCTTTAAGCAAAAAATGGAGAGG - Intronic
1131636950 15:94246010-94246032 TGTGTAGGCTGAGAGTGGGGAGG + Intronic
1132661310 16:1062711-1062733 TCTTCAGGCAGAGAGTTTGGGGG + Intergenic
1133195955 16:4170462-4170484 TCTCCAGGCAGACAGTGGGTGGG + Intergenic
1138121762 16:54405894-54405916 TCTTCAGGGAGAAATTGGAGTGG - Intergenic
1138640118 16:58379010-58379032 ACTTGAGGCAGGAAGTAGGGAGG + Intronic
1139494801 16:67308614-67308636 TCTTCAGGAAGAGAATGGGGAGG - Intronic
1139527352 16:67525109-67525131 TCCCTAGGCAGACAGTGGGTAGG - Intronic
1140005693 16:71072857-71072879 TCTTCAGTTAGAAAGAGGGGAGG - Intronic
1140313410 16:73870849-73870871 GTTTTAAGAAGAAAGTGGGGAGG - Intergenic
1140506054 16:75473581-75473603 CCTTTAGGCAGAAAAGGGGAGGG - Exonic
1142980165 17:3666985-3667007 TCTTTAGGTAGAAGGGGGGCAGG - Intronic
1142996322 17:3762477-3762499 TCCTGAGGCTGACAGTGGGGAGG - Intronic
1143415509 17:6745898-6745920 ACTTGAGGCTGAAAGTTGGGAGG + Intergenic
1143547685 17:7608249-7608271 TCTTTAGGTAAAAAATGGGCTGG - Intronic
1144273015 17:13637402-13637424 TATTTAGGCAGATAGTGAGAGGG - Intergenic
1144643825 17:16954930-16954952 TCCTTAGATAGAAACTGGGGTGG - Intronic
1145782529 17:27572427-27572449 TCTTTAGACAGAAGCTGGGGTGG + Intronic
1146147174 17:30429932-30429954 ATTTTAGGCAGAAAGAGGGAGGG + Intronic
1146522020 17:33532808-33532830 GCTCTAGGCAGAAAGAGGAGAGG - Intronic
1147539496 17:41345215-41345237 TGTTTAGGTAGAAAGTAGGAAGG - Intergenic
1148794560 17:50190782-50190804 TGTTAGGGCAGAAGGTGGGGAGG + Intronic
1152114173 17:78374814-78374836 TCTGGAGGCAGAAGGTGGGCCGG + Intergenic
1152136171 17:78505056-78505078 TCCTTAGGGAGAAAGGGGAGGGG - Intronic
1153969723 18:10215307-10215329 TCTGTAGGGAGAGACTGGGGAGG + Intergenic
1154513307 18:15134096-15134118 TCTTGAGGCAGAGATTGGGGGGG + Intergenic
1155474616 18:26226131-26226153 TTTTTAAGGAGAAAATGGGGAGG - Exonic
1156460425 18:37318636-37318658 TCTTGCAGTAGAAAGTGGGGGGG - Intronic
1157189531 18:45569042-45569064 TCTTTAGGGAGAAATGGGAGAGG - Intronic
1157565542 18:48676815-48676837 TCTTTAGAGAGGTAGTGGGGAGG - Intronic
1158061312 18:53347152-53347174 TCTTCTGGCACAAAGTGGTGAGG + Intronic
1159288144 18:66379509-66379531 ACTTTAGGCAGAAAGAGAGCTGG + Intergenic
1159655350 18:71025742-71025764 CCTTTAGGCATAAAAGGGGGAGG + Intergenic
1160847182 19:1171747-1171769 GCCTTAGGCAGCAAGTGGGTGGG + Intronic
1163345225 19:16737041-16737063 TCTATAGACATAAAGTGGAGGGG - Intronic
1163535592 19:17874472-17874494 TCTGTAGACAGAGTGTGGGGCGG - Exonic
1164332177 19:24270216-24270238 TCTTTAGGTAGAATCTGGGAAGG - Intergenic
1164513405 19:28915110-28915132 TCTTTAAGAAGAAAGTGGCAGGG - Intergenic
1165372393 19:35417383-35417405 TCTTGAGGGAGGATGTGGGGTGG + Intergenic
1166290839 19:41862395-41862417 GTTTTAGACAGAAAATGGGGCGG + Intronic
1166741892 19:45119519-45119541 TCTGAAGCCAGAAAGTGGGTCGG - Intronic
1168098984 19:54131021-54131043 TCCTTATGCAGAAACTGGGCAGG + Intronic
927286611 2:21363394-21363416 TATTTAGGCAGATAGTGAGGGGG - Intergenic
927430047 2:23019802-23019824 TCTTTAGGCATAAAGAGAGGAGG + Intergenic
927446756 2:23169390-23169412 TCATTCGGCAGCAAGTGGTGCGG + Intergenic
929283370 2:40107630-40107652 TCTTTAGCTAAAAAGGGGGGAGG + Intronic
929854216 2:45622010-45622032 TCCTGGGGCAGAAAGTAGGGTGG + Intergenic
933286250 2:80387451-80387473 TATATAGGGAGACAGTGGGGTGG + Intronic
936039404 2:109138351-109138373 TCTGTAGGGAGAAAGTAGTGGGG + Intronic
936651604 2:114433566-114433588 TCTATGGGCATAGAGTGGGGAGG + Intergenic
936687994 2:114850659-114850681 TCTGGAAGCAGAAACTGGGGAGG - Intronic
936826405 2:116587113-116587135 TTTTTTGGAAGAGAGTGGGGAGG + Intergenic
937034008 2:118765557-118765579 TCTTGGGGCATGAAGTGGGGAGG + Intergenic
937897709 2:126991073-126991095 CCTTTAGGCAGAAATTGAGGGGG + Intergenic
938513555 2:131978707-131978729 TCTTGAGGCAGAGATTGGGGGGG + Intergenic
941885502 2:170523441-170523463 TTTTTGGGCAGAGGGTGGGGTGG + Intronic
943312349 2:186342332-186342354 TCTTTAGGCAGAAAGAGAAGAGG + Intergenic
945170863 2:206993613-206993635 TCTTCAGCCAGAAGGTGGAGTGG + Intergenic
945836273 2:214839177-214839199 CCTTTAGGCAGGAAAGGGGGAGG + Intergenic
946273431 2:218612834-218612856 CCTTCAGGGAGAATGTGGGGGGG - Intronic
947328887 2:229007467-229007489 TCCTTAGGGATAAAGAGGGGTGG + Intronic
947612573 2:231532995-231533017 TCTGTAGGCAGTAAGTGGGGTGG - Intergenic
947899882 2:233712461-233712483 TCTTTAAACAGGGAGTGGGGAGG - Intronic
948031285 2:234819670-234819692 TCTGTAGGCAGCATGTGGGAAGG - Intergenic
1172473687 20:35221136-35221158 TCTTTAGGAAGATAGTCGGTTGG - Intergenic
1173830307 20:46079808-46079830 TTGTGAGGAAGAAAGTGGGGGGG + Intronic
1174543801 20:51309804-51309826 TCTTGAGGCAGAAAGAGAGGGGG - Intergenic
1174933098 20:54836992-54837014 CCTTGAAGGAGAAAGTGGGGAGG + Intergenic
1176780227 21:13184187-13184209 TCTTGAGGCAGAGATTGGGGGGG - Intergenic
1177387991 21:20432710-20432732 TAATTAAGAAGAAAGTGGGGAGG + Intergenic
1181822867 22:25489142-25489164 TCTTAAGGCACATCGTGGGGTGG + Intergenic
1184344910 22:43907358-43907380 CCTGTAGGAAGAAAGAGGGGAGG - Intergenic
1185391673 22:50564846-50564868 TCTTTAGCCAGAGGGTGTGGAGG + Intergenic
949916714 3:8970412-8970434 TCTTTTGGTAGAGACTGGGGTGG - Intergenic
950162529 3:10771218-10771240 TCCTACTGCAGAAAGTGGGGAGG + Intergenic
950166010 3:10799516-10799538 TCTTCAGGAAGAGGGTGGGGTGG - Intergenic
952371300 3:32725330-32725352 TCTTTAGGGAGTAAGTGGAATGG + Intronic
953114375 3:39977326-39977348 TCTCTTGGGAGAAAATGGGGTGG + Intronic
955001833 3:54934367-54934389 TCTCTAGTAAGAAAGTGGGGAGG + Intronic
956881866 3:73519178-73519200 CCCTTGGGCAGAAAGTAGGGTGG + Intronic
959111706 3:102130645-102130667 TCTTATAGCAGAAAGTGGAGGGG - Intronic
959892200 3:111570033-111570055 TCGGTAGGCAGGAATTGGGGTGG + Intronic
961112404 3:124296297-124296319 TCTTTAGGCAGCATCTGTGGTGG + Intronic
961644368 3:128384796-128384818 TCTCTTGGCAGACAGTGAGGAGG - Intronic
963669500 3:148233792-148233814 TTTTTAGTCAGAAAGAGGGAGGG + Intergenic
964025442 3:152068205-152068227 TCTTCAAGCAGAAAGTGAGGTGG + Intergenic
970690797 4:18618319-18618341 GCTATAGGCAGGAAGTGTGGAGG - Intergenic
970860219 4:20693962-20693984 CATTTAGGCACACAGTGGGGAGG - Intergenic
971035984 4:22693262-22693284 TCTTTAGGCACAAGGAAGGGTGG + Intergenic
973022652 4:45222790-45222812 TCTTTAGTCAGAAGCTTGGGTGG - Intergenic
974117516 4:57598293-57598315 TATTTTGACAGAAGGTGGGGTGG + Intergenic
975581446 4:75910488-75910510 TTTTCAGGAAGAAAATGGGGAGG + Intergenic
976144792 4:82032052-82032074 TCTGTTAGGAGAAAGTGGGGTGG - Intronic
980147139 4:129001313-129001335 TCTTGAATCAGAAACTGGGGTGG + Intronic
980517998 4:133889754-133889776 TGTGTAGGCTGAGAGTGGGGTGG + Intergenic
982112404 4:152068994-152069016 TCTGTAGGGAGAGTGTGGGGTGG + Intergenic
983655466 4:170079384-170079406 ATTTTAGGAAGAGAGTGGGGAGG + Intronic
984434286 4:179688760-179688782 TCTTTAGCCAGAAAATCAGGAGG + Intergenic
985720956 5:1488816-1488838 TCATCAGGAAGAAGGTGGGGAGG + Intronic
986901682 5:12442345-12442367 ACTTTATGTAGAAAGTGGAGTGG - Intergenic
988682155 5:33494153-33494175 TCCTGAGGCAGAAAGTCAGGAGG + Intergenic
991040744 5:62172941-62172963 GCTTCAGGCTGAGAGTGGGGTGG + Intergenic
992201675 5:74390809-74390831 TCTTTAGGGTGAAATTGTGGAGG + Intergenic
995533735 5:113115328-113115350 TCTATAGTCAGAATGTGGTGGGG - Intronic
996347490 5:122502634-122502656 TCATTAGGCAGAAAATAGTGAGG - Intergenic
996432576 5:123398081-123398103 TCTTAGGGGAAAAAGTGGGGAGG + Intronic
998132598 5:139658977-139658999 TCCTGAGGCAGAAAGTGTGGTGG + Intronic
999596320 5:153209003-153209025 TCATTAGGCAGAATCTGGAGAGG - Intergenic
999767311 5:154750964-154750986 GCTTTAGGCAGAAAGTGACAAGG - Intronic
1002539385 5:179895946-179895968 CTTTTAGGCAGAAAGGGGGAGGG - Intronic
1003200715 6:3957830-3957852 CTTTTAGGCAGAAAGGGGGCAGG - Intergenic
1003313155 6:4986807-4986829 TCTTAATGAAGAAAGTGGGGTGG + Intergenic
1003421710 6:5964144-5964166 ACATTAGGCAGAGTGTGGGGTGG - Intergenic
1003429054 6:6022353-6022375 TCTTAGAGCAGAAAGTGGGTGGG + Intergenic
1004650415 6:17602023-17602045 TTTCTAGGGGGAAAGTGGGGAGG + Intronic
1006795946 6:36732404-36732426 ATTTTAGGGAGAATGTGGGGGGG + Exonic
1009269278 6:61598088-61598110 TCTTGTGGCAGGGAGTGGGGTGG - Intergenic
1010804007 6:80213603-80213625 GCTTTGGGCAGAGAGTGAGGGGG - Intronic
1011174672 6:84546772-84546794 TCTTTAAGCATAAAGTGATGAGG + Intergenic
1011377021 6:86699541-86699563 TTTGTAGGCAGAACCTGGGGAGG + Intergenic
1015984219 6:138869605-138869627 TGTTTTGGCAGACAGTGAGGGGG - Intronic
1018203389 6:161415245-161415267 GTTTAAGGCAGAAAATGGGGAGG - Intronic
1020998462 7:15296192-15296214 TTTTTAGGCATAATGTGGAGTGG - Intronic
1023634515 7:42196247-42196269 TCTTTTAGCAGAAAGTGGTAAGG + Intronic
1027983971 7:85261608-85261630 TCTTTTGGAAGAAAGTGGGATGG - Intergenic
1028121046 7:87057262-87057284 TTTTTAAGAGGAAAGTGGGGAGG - Intronic
1028123542 7:87085055-87085077 TCTTGTGGCAGAAATGGGGGAGG - Intergenic
1029306635 7:99624568-99624590 TCTTGCGGCAGGAAGTGGGCAGG + Intronic
1030703239 7:112663650-112663672 CCTTAATGCAGAAAGTGGTGTGG + Intergenic
1030887369 7:114954913-114954935 TATAGAGGCAGAAAGTGGTGAGG - Intronic
1031100370 7:117472477-117472499 TCTTGCAGCAGAAAATGGGGTGG - Intronic
1032098135 7:128949912-128949934 GCTGAAGGCAGAAAGTGGGCTGG - Intronic
1035617561 8:1013407-1013429 TCTCTAGGGAGAAAGATGGGAGG + Intergenic
1036719429 8:11159459-11159481 TCTGTTAGCAGAAAGTGAGGCGG - Intronic
1037377211 8:18243854-18243876 GCTTTAGGCAAAGAGTGGGCTGG - Intergenic
1037711606 8:21359722-21359744 TCCTCAGGCAGCAAGTGGGGTGG + Intergenic
1038948616 8:32389615-32389637 CATTTAGGCAGAAAGTCAGGTGG - Intronic
1042913935 8:73856296-73856318 TTTAAAGGTAGAAAGTGGGGAGG - Intronic
1044747870 8:95388720-95388742 GCTTTAAGCAGAAAGTAGGAGGG - Intergenic
1044763141 8:95543586-95543608 AATTCAGGAAGAAAGTGGGGAGG + Intergenic
1046121904 8:109857579-109857601 TCTTTAGGCAGAAAAGGGGGAGG + Intergenic
1047104043 8:121713675-121713697 TCTTTGGTCAGAAAGAGAGGGGG - Intergenic
1048430784 8:134368569-134368591 TCTGAAGGCAGAAAGTCAGGAGG + Intergenic
1049533290 8:143167036-143167058 CGTCTAGGGAGAAAGTGGGGAGG + Intergenic
1049533320 8:143167138-143167160 CGTCTAGGGAGAAAGTGGGGAGG + Intergenic
1049533714 8:143168464-143168486 CGTCTAGGGAGAAAGTGGGGAGG + Intergenic
1051497214 9:17736848-17736870 TCTATAGGCAGAAAGTGAGATGG + Intronic
1051601771 9:18882134-18882156 TATTTAGGCAGAAAAAGGAGTGG - Intronic
1055257251 9:74386121-74386143 CCTTTAGGCAGAAAATAGGGTGG - Intergenic
1055600240 9:77909035-77909057 TCTATAAACAGAAAGTGGAGAGG - Intronic
1057259473 9:93576125-93576147 CCTTGAGACTGAAAGTGGGGTGG - Intergenic
1058751818 9:108046471-108046493 TATTTGGGCAGTAAGTGGGATGG + Intergenic
1058807356 9:108605280-108605302 TGTTTAGGCAGATAATGGTGAGG + Intergenic
1059228259 9:112693299-112693321 TCTTTAGGCAGAAAGTGGGGAGG - Intronic
1060247836 9:121961217-121961239 TCTTGAGGAAAAAAGTGTGGAGG - Intronic
1060370692 9:123067876-123067898 TCTATAGGTAGAAAATGGAGGGG - Intronic
1061113403 9:128591748-128591770 TCTGTGGGCTCAAAGTGGGGTGG - Intronic
1061130551 9:128705629-128705651 TCTATAGGCAGGAAATGAGGTGG - Intronic
1061684211 9:132261214-132261236 TCATTAGGCTGGAATTGGGGTGG - Intergenic
1062199840 9:135296710-135296732 ATTTTAGGCAGAAAGAGGGAGGG + Intergenic
1062720043 9:138036105-138036127 TCTTCAGGCAGAAGGGGCGGGGG - Intronic
1185815421 X:3150689-3150711 CTTTTAAGCAGAAAGTGGGAGGG - Intergenic
1186688951 X:11954567-11954589 TCTTTAGGTAGGAAGTAAGGAGG + Intergenic
1187074649 X:15921866-15921888 TCTTTAGGCAAAAAGTGAAGGGG - Intergenic
1187668281 X:21640463-21640485 TCTTTTTGCAGAAATGGGGGTGG - Intronic
1187684433 X:21802328-21802350 TCTTATGCCAGAAAGTGGGAAGG + Intergenic
1188695346 X:33183605-33183627 TGTCTAGGCAGGAAGTTGGGAGG - Intronic
1190117589 X:47636468-47636490 TCTTGGGGAAAAAAGTGGGGAGG + Exonic
1190862924 X:54360563-54360585 ACTGTAGGCAGAAAGGGGAGCGG + Intergenic
1193508252 X:82369860-82369882 TCTCTAAGCAGAAAGTTGGATGG - Intergenic
1193862971 X:86694069-86694091 GTTTTAGGCAGTAAGTGGGATGG + Intronic
1194240124 X:91435171-91435193 TATTTATGCAGAAAGCGGGTCGG + Intronic
1194983224 X:100461598-100461620 TCTCAAGGAAGGAAGTGGGGTGG - Intergenic
1195386560 X:104318990-104319012 CCTTTTGGGAGACAGTGGGGAGG + Intergenic
1195491190 X:105471869-105471891 TCTTTAGTCAAAAAGTGGTCAGG - Intronic
1195751730 X:108166111-108166133 TCTTTGGCCAAAAAGGGGGGAGG - Intronic
1196053828 X:111333863-111333885 TCTTTGTGCAGAAAGGGGGTTGG - Intronic
1196190604 X:112790472-112790494 CACTTAGGCAGAAATTGGGGGGG + Intronic
1198405251 X:136305723-136305745 ACTTTACTAAGAAAGTGGGGAGG - Intronic