ID: 1059232278

View in Genome Browser
Species Human (GRCh38)
Location 9:112732009-112732031
Sequence TGTGCTTGGGATCTGGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059232273_1059232278 29 Left 1059232273 9:112731957-112731979 CCAGTACACACACGCGAGCACAT No data
Right 1059232278 9:112732009-112732031 TGTGCTTGGGATCTGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059232278 Original CRISPR TGTGCTTGGGATCTGGCATT TGG Intergenic
No off target data available for this crispr