ID: 1059234704

View in Genome Browser
Species Human (GRCh38)
Location 9:112751333-112751355
Sequence GGTCGCAGCCGCAGAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059234692_1059234704 18 Left 1059234692 9:112751292-112751314 CCGGAGCCCTCGGCGAAGCGTCT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145
1059234693_1059234704 12 Left 1059234693 9:112751298-112751320 CCCTCGGCGAAGCGTCTCCTCTG 0: 1
1: 0
2: 0
3: 7
4: 43
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145
1059234689_1059234704 25 Left 1059234689 9:112751285-112751307 CCTGGCCCCGGAGCCCTCGGCGA 0: 1
1: 0
2: 1
3: 12
4: 176
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145
1059234698_1059234704 -5 Left 1059234698 9:112751315-112751337 CCTCTGCCGCCTCCGCGGGGTCG 0: 1
1: 0
2: 5
3: 20
4: 243
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145
1059234694_1059234704 11 Left 1059234694 9:112751299-112751321 CCTCGGCGAAGCGTCTCCTCTGC 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145
1059234691_1059234704 19 Left 1059234691 9:112751291-112751313 CCCGGAGCCCTCGGCGAAGCGTC 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145
1059234690_1059234704 20 Left 1059234690 9:112751290-112751312 CCCCGGAGCCCTCGGCGAAGCGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059234704 Original CRISPR GGTCGCAGCCGCAGAGGGAC AGG Intronic
900662406 1:3791389-3791411 GCACGCAGCCACAGAGAGACAGG + Intronic
901230652 1:7640151-7640173 GGTCACAGCCGGAGGGGGAGGGG + Intronic
901875259 1:12163882-12163904 GGTCGCAGCTGCAGGGGGCAGGG - Intergenic
902251010 1:15154119-15154141 GGGCGCGGCCGCAGAGGGTGCGG - Intronic
905714135 1:40133448-40133470 AGTAGCGGCCGCAGCGGGACTGG + Intergenic
908413835 1:63893044-63893066 GGTGTCAGCCGCAGAGGGTGCGG + Intronic
915362525 1:155294738-155294760 GTCCGCAGGCCCAGAGGGACTGG - Exonic
915598461 1:156908302-156908324 GGTCGCAGGTGCAGGGGGCCTGG - Exonic
916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG + Exonic
917645422 1:177024555-177024577 GGTCGCATCCTCAGAAGAACAGG + Intronic
918535000 1:185564341-185564363 GGTCCCTGCAGCAGAGGGAACGG - Intergenic
918676999 1:187299305-187299327 GGTAGCAGCAGCAGAGTGAAGGG + Intergenic
922917582 1:229271184-229271206 GGCCGCAGCCGCTGGGAGACCGG + Exonic
1064030627 10:11880540-11880562 AGTCCCAGCCGCCGAGGGAGAGG + Intergenic
1071602944 10:86967800-86967822 GGATGCAGCCGGAGAGGGCCTGG - Intronic
1072189087 10:93066138-93066160 GCTCGCAGCCGCAGTCGGGCGGG - Exonic
1075007700 10:118842471-118842493 GGTGGCAGCGGCAGGGGGTCGGG - Intergenic
1076377780 10:130003120-130003142 GGTTGCACCTGCAGTGGGACAGG - Intergenic
1082781895 11:57294485-57294507 GGGAGCAGCCTCAGAGGGGCAGG - Intergenic
1085098394 11:73779535-73779557 TCTCGCAGCCCCAGAGGGGCGGG + Intergenic
1089518683 11:119049484-119049506 GGTAGTAGCCGCAGAGGAAGGGG - Intronic
1092938614 12:13386829-13386851 GGTCTCAGCCCCAGAGAGTCTGG + Intronic
1093125399 12:15322570-15322592 GGGAGCAGGCGCAGGGGGACTGG + Exonic
1096337072 12:50764439-50764461 GGGCGCAGCGGCAGGGGGAGGGG + Intronic
1098278317 12:68835734-68835756 GCTGGCAGCAGCAGAGGCACAGG + Intronic
1103930062 12:124445315-124445337 CGGGGCAGCCGCAGAGGGGCAGG - Intronic
1104416331 12:128599099-128599121 AGCTGCAGCCGCAGAGGAACGGG - Intronic
1106364589 13:29066153-29066175 TGTCTCTGCCTCAGAGGGACAGG + Intronic
1113605512 13:111602323-111602345 TGTGGCAGCCGCAGGGGCACAGG - Intronic
1113656189 13:112068848-112068870 GGTCGCCGCCGCAGAGTCCCCGG - Exonic
1113682573 13:112254596-112254618 GGTCTCAGCCCAAGAGAGACAGG + Intergenic
1113949655 13:114064950-114064972 GGTCTCTGCCTCAGAGGGAGAGG - Intronic
1121404972 14:93714187-93714209 GGTCTCTGCTGCAGAGGGGCTGG - Intergenic
1122782866 14:104150940-104150962 GGGTGCAGACGCAGAGGGCCTGG + Intronic
1125954094 15:43777311-43777333 GGTTTCAGCCGCAGAGGGGCGGG + Exonic
1128651153 15:69414596-69414618 GGTCGCGGCCGCAGCAGCACCGG - Intronic
1130243419 15:82220144-82220166 GCTTGCAGCAGCACAGGGACAGG - Exonic
1131111415 15:89767299-89767321 GGTCCCAGCCCCAGGGGGCCAGG - Intronic
1132756157 16:1486466-1486488 GGACCCAGCTGCAGAAGGACAGG + Exonic
1133013942 16:2930340-2930362 GGTCGCAGGCACAGAGAGCCAGG - Intronic
1137660887 16:50205145-50205167 GATCACATCCGAAGAGGGACTGG - Intronic
1139775956 16:69317126-69317148 GTTCCCATCCGCAGAGGGAGAGG + Intronic
1139949240 16:70661122-70661144 GATCCCAGCTGCAGGGGGACAGG - Intergenic
1140270036 16:73457342-73457364 GGTGGCAGCCCCAGAGCGCCTGG + Intergenic
1140780762 16:78294289-78294311 GGTTGCAGATGCAGAGGCACTGG + Intronic
1142032774 16:87846737-87846759 GGTCTCAGCTTCAGAGGGTCTGG - Intronic
1142379652 16:89724064-89724086 GGCAGCAGCCGCAGAGGCAACGG - Intronic
1142403645 16:89873978-89874000 GGTCCCAGCCGCAGTGGGGAGGG + Intronic
1142606989 17:1087486-1087508 GGTCTCAGCTGCAGAAGGGCAGG + Intronic
1143237983 17:5419629-5419651 GATGGCGGCCGCCGAGGGACCGG - Exonic
1144455168 17:15412726-15412748 GGTGCCAGCCCCAGAGTGACTGG + Intergenic
1144724866 17:17496677-17496699 GCCCGAAGTCGCAGAGGGACAGG - Intergenic
1147333354 17:39712083-39712105 GGCTGCATGCGCAGAGGGACAGG - Intronic
1148684676 17:49494986-49495008 GGCCGCAGCCGGAGAGGAACAGG + Intergenic
1150143591 17:62750256-62750278 GGTCTCAGCCGGAGTGGGGCAGG + Intronic
1152245177 17:79181719-79181741 CGTAGCAGCCGCAGAGGGACAGG - Intronic
1152579526 17:81159931-81159953 GGTCCCTGCTGCTGAGGGACAGG - Intronic
1152665653 17:81567644-81567666 GGTTGCAGAGGCAGAGGGAGAGG - Intronic
1152758271 17:82096180-82096202 GGTCCCAGCTGCAGAGCCACTGG - Intronic
1153520134 18:5943895-5943917 TATCCCAGCAGCAGAGGGACTGG + Intergenic
1153672717 18:7427887-7427909 GGTCCCTGCTGGAGAGGGACAGG + Intergenic
1156987035 18:43360826-43360848 GGTGGCAGCCACAACGGGACAGG + Intergenic
1160675633 19:389870-389892 GGTTGGGGCTGCAGAGGGACTGG - Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161898299 19:7099154-7099176 GGTCGGAGACAGAGAGGGACAGG + Intergenic
1162315490 19:9936153-9936175 GGTCGCAGCGGGGGAGGGGCCGG - Intronic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1166328040 19:42063059-42063081 GGACACAGCAACAGAGGGACAGG + Intronic
1166641530 19:44498686-44498708 GGGAGCAGCTGCAGAGGGGCGGG - Intronic
1167310924 19:48737565-48737587 GGGCGGAGCCGCTGAGGGGCCGG - Intronic
1167898642 19:52601726-52601748 GGACGCAGCCTCCGCGGGACTGG - Intronic
925157915 2:1661423-1661445 AGAGGCAGACGCAGAGGGACAGG + Intronic
925973458 2:9124269-9124291 AGTCACAGCCACACAGGGACTGG - Intergenic
934523215 2:95032839-95032861 GGTAGCAGCGGCAGAGAGCCTGG - Intronic
940076362 2:149746598-149746620 GGTTGCTGCCACCGAGGGACTGG - Intergenic
942250033 2:174039674-174039696 GGTGGCAGCAGCACTGGGACAGG + Intergenic
943185162 2:184598306-184598328 CGCCGCTGCCGCAGAGGGCCGGG - Intergenic
946309265 2:218873689-218873711 GGTCGCAGCCGCTGAGGTCCGGG - Exonic
1169065820 20:2693584-2693606 GCCCGCAGCCTCAGCGGGACCGG + Intronic
1172751861 20:37256901-37256923 GGTGGCACCTGCAGAGTGACAGG + Exonic
1173503595 20:43570528-43570550 GCTCGCAGCCGCACAGGGCGGGG + Intronic
1174355956 20:49998085-49998107 GGTGACAGCCACAGAGGGAGAGG + Intergenic
1175853106 20:62104344-62104366 GCACGCAGCCCCAGGGGGACGGG + Intergenic
1176095782 20:63343737-63343759 GCAAGCAGCCGCAGAGGGGCCGG + Intronic
1176546632 21:8205154-8205176 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176554526 21:8249345-8249367 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176565583 21:8388201-8388223 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1176573448 21:8432369-8432391 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1178431482 21:32522121-32522143 GGCTGCAGCCCCAGGGGGACAGG - Intergenic
1179478730 21:41664599-41664621 GGTGTCACCCGCAGAGGGAGGGG + Intergenic
1179563986 21:42235014-42235036 GGTCGCAGCCTCCCTGGGACAGG + Intronic
1180740851 22:18052398-18052420 GGCAGCAGCAGCAGAGGCACCGG + Intergenic
1181469203 22:23127563-23127585 GGTGGCTGCTGAAGAGGGACAGG + Intronic
1181575462 22:23791702-23791724 GGTCGCAGCACCACAGGGAAGGG - Intronic
1182097346 22:27634928-27634950 GGGTGCAGCGGCAGGGGGACAGG - Intergenic
1182123895 22:27802585-27802607 CTTCGCACCCGCAGAGGGTCTGG - Intergenic
1183156703 22:36081338-36081360 GGCCGCTGCCACAAAGGGACAGG - Intergenic
1183406583 22:37633259-37633281 GGTCACAGCCTCAGGGGGCCAGG + Exonic
1184653784 22:45931265-45931287 GGTCGCAGCCGCAGTTGCTCAGG + Exonic
1184698282 22:46151349-46151371 GGTCGGGGCCGCTGAGGGTCGGG + Intronic
1185266601 22:49907242-49907264 GGTAGCAGCGGCAGAGGGCAGGG - Intronic
1203251497 22_KI270733v1_random:121420-121442 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203259547 22_KI270733v1_random:166502-166524 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
950153830 3:10707991-10708013 AGCCGCAGCCGCAGCGGGGCCGG - Intronic
955285336 3:57635311-57635333 GGTCTGAGCCACAGATGGACAGG + Intronic
955495053 3:59522344-59522366 GGTCACAGATGCAGTGGGACTGG - Intergenic
958019222 3:87978055-87978077 GCTGGCAGCTGCAGAGGGGCGGG + Intergenic
961126056 3:124418877-124418899 GGTCCCAGCCGCAGAGATTCTGG + Intronic
968084278 3:195867566-195867588 GGGGGCAGCAGCAGAGGCACAGG + Exonic
968359045 3:198133778-198133800 GGAGGCAGCCGGAGATGGACCGG - Intergenic
968603329 4:1520608-1520630 GGTCGCCGCCGCGTAGGGAGGGG - Intergenic
968756105 4:2417424-2417446 TGGCGCAGCCGCTGAGGCACGGG + Intronic
968986204 4:3875916-3875938 GGTTCCAGCAGCAGAGGCACCGG - Intergenic
969321982 4:6417952-6417974 TGTCCCAGCGGCAGAGGGTCAGG - Intronic
969511827 4:7622498-7622520 GGACGCAGCAGCAGAGGGGCCGG - Intronic
970025042 4:11614893-11614915 GGTTGCTGCAGCAAAGGGACAGG - Intergenic
976236277 4:82900710-82900732 GGTCGTAGCCGCAGAGTCAACGG + Intronic
983522364 4:168723096-168723118 GGTCGCAGGAGCAGAGGAAGTGG + Intronic
985759866 5:1742889-1742911 GGTCTCAGCCCCAGTGAGACTGG + Intergenic
995854235 5:116575791-116575813 GGGCGCAGCGGCAGGGGGAGGGG - Intergenic
996765287 5:127030060-127030082 TGTCGTTGCCGCAGAGGGGCAGG + Intronic
999281577 5:150369734-150369756 GGCTGCAGCCGGAGAGGGGCAGG + Intronic
1002900735 6:1407724-1407746 GGAGGCAGCCGCAGAGGAGCTGG - Intergenic
1003655506 6:8003413-8003435 GGCTGCAGCCGCAGAGGGAATGG + Intronic
1005362459 6:25043632-25043654 GGTGCCAGAAGCAGAGGGACTGG + Intergenic
1006299367 6:33185531-33185553 GGGCGCTGCAGCAGAGAGACAGG + Intronic
1007476510 6:42123079-42123101 GCTCTCAGACGCAGAGGGACAGG + Intronic
1014018793 6:116565132-116565154 GGTAGCTGCCGCAGCGGGGCGGG + Intergenic
1017146772 6:151241252-151241274 GGCCGCTGCCGCAGGAGGACTGG - Intronic
1018829017 6:167428016-167428038 GGTCGCAGGAGGAGAGGCACAGG + Intergenic
1018892296 6:167990625-167990647 GGCCTCAGGAGCAGAGGGACGGG - Intergenic
1024524432 7:50336414-50336436 GGTTGCAGGCTCAGAGGCACAGG + Intronic
1024996695 7:55278046-55278068 GGACCCGGCCACAGAGGGACTGG - Intergenic
1026360852 7:69599697-69599719 GGTCGCGGTCGCAGCGAGACCGG + Exonic
1031968286 7:128044314-128044336 GGCCGCATCCACAAAGGGACAGG + Intronic
1034343553 7:150372354-150372376 CGTCGCAGCTGTAGAGGGAGGGG - Exonic
1034492542 7:151401544-151401566 AGAGGCAGCCGCAGAGGGAATGG + Intronic
1035599731 8:890572-890594 TTACGCAGCCGCAGAGGGAAGGG - Intergenic
1037804485 8:22051418-22051440 TGTCTCAGCGTCAGAGGGACAGG - Intronic
1038641774 8:29334672-29334694 GGTCCCAGCAGCAGAGAGACAGG - Exonic
1045327465 8:101127427-101127449 GGGCGCTGCAGCAGATGGACAGG + Intergenic
1045418539 8:101991315-101991337 GGTAGCAGCCTCATAGGAACAGG - Intronic
1049155203 8:141062039-141062061 AGTGGCAGCTGCAGAGGGATTGG - Intergenic
1049747845 8:144270545-144270567 GGTAGCAGCGGCCGAGGGCCCGG + Intronic
1054324144 9:63704715-63704737 CGGCGCAGGCGCAGAGAGACAGG + Intergenic
1055772359 9:79730896-79730918 CGTCCCAGCAGCACAGGGACTGG + Intergenic
1056842638 9:90010908-90010930 GGGCCCAGCATCAGAGGGACCGG + Intergenic
1059234704 9:112751333-112751355 GGTCGCAGCCGCAGAGGGACAGG + Intronic
1062282899 9:135759885-135759907 GGTGGCACCAGCAAAGGGACAGG + Intronic
1062440159 9:136566165-136566187 GGTCGCAGCCCCAAAGGGGAGGG + Intergenic
1062581410 9:137230734-137230756 GGTCCTAGCCACAGAGTGACAGG + Intergenic
1203467899 Un_GL000220v1:104571-104593 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1203475720 Un_GL000220v1:148543-148565 GGTGGCAGCTGCCGAGGGAGGGG + Intergenic
1192261093 X:69506187-69506209 GGCAGCGGCCGCAGTGGGACCGG + Intronic
1193467794 X:81868870-81868892 GGACCCAGCCTCAGAGGGGCTGG + Intergenic