ID: 1059234829

View in Genome Browser
Species Human (GRCh38)
Location 9:112752064-112752086
Sequence ATTCATTTAGTATTTTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 513}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059234829_1059234832 1 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT 0: 1
1: 0
2: 4
3: 44
4: 513
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data
1059234829_1059234834 2 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT 0: 1
1: 0
2: 4
3: 44
4: 513
Right 1059234834 9:112752089-112752111 CCCCTTGTCCCAATATTAATGGG No data
1059234829_1059234838 9 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT 0: 1
1: 0
2: 4
3: 44
4: 513
Right 1059234838 9:112752096-112752118 TCCCAATATTAATGGGAGCAGGG No data
1059234829_1059234837 8 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT 0: 1
1: 0
2: 4
3: 44
4: 513
Right 1059234837 9:112752095-112752117 GTCCCAATATTAATGGGAGCAGG No data
1059234829_1059234840 10 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT 0: 1
1: 0
2: 4
3: 44
4: 513
Right 1059234840 9:112752097-112752119 CCCAATATTAATGGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059234829 Original CRISPR ATTCATTTAGTATTTTACTA GGG (reversed) Intronic
901249329 1:7762597-7762619 CTTCATTTATGATTTCACTAGGG + Intronic
905288148 1:36899703-36899725 ATTCATTTACTTTTTTATTGTGG - Intronic
905660125 1:39715666-39715688 ATTTATTTTGTCTTTTATTAGGG - Intronic
908214927 1:61941779-61941801 ATTATTTTAATATTTTACTCTGG + Intronic
908596673 1:65695926-65695948 ATTCATTTATTTTTTTAAGACGG + Intergenic
909250716 1:73351896-73351918 AGTCATTTAATGTTTTACTTAGG - Intergenic
909680588 1:78287185-78287207 ATTCATTTAGAAGTTTTTTAAGG - Intergenic
909692046 1:78420499-78420521 ATACGTTTTGTATTTGACTATGG + Intronic
909693131 1:78433070-78433092 AGTTATCTACTATTTTACTATGG + Intronic
909765013 1:79344573-79344595 ATTCAATTAGTATGATAATAAGG + Intergenic
910010799 1:82459332-82459354 ATTCATGTGGTATTTGACTTTGG - Intergenic
910155012 1:84207004-84207026 TGTCATTTACTATTTTGCTATGG + Intronic
910415563 1:86993574-86993596 ATCCATATAGTATTTTTATATGG - Intronic
911832295 1:102567197-102567219 CTCTATTTAGTATTTTACTTTGG - Intergenic
912719688 1:112009470-112009492 TTTCATTTAATATTATACTTTGG + Intergenic
914687616 1:149995018-149995040 ATTTATTAAGTATTTAACTGTGG - Intronic
915721028 1:157985784-157985806 CTTCATTTTGTTTTTTACTTGGG + Intergenic
916260547 1:162837886-162837908 ATTGCTTTAGTATTTTATAATGG - Intronic
916661835 1:166929364-166929386 ATTCAGTTTGAATTTTATTATGG + Intronic
917620973 1:176795318-176795340 ATTCATTTCATCTTTTACTCAGG + Intronic
917893100 1:179458730-179458752 ATTTATGTAGTTTTTTTCTAGGG - Intronic
917990632 1:180374323-180374345 AAGAGTTTAGTATTTTACTATGG + Intronic
918220356 1:182431146-182431168 ATTAATATAATATTTTATTATGG + Intergenic
919001830 1:191842512-191842534 ATTTATTTTATATTTTACTGGGG + Intergenic
919015291 1:192025707-192025729 ATTGATTTATTCTTTTGCTATGG + Intergenic
919094792 1:193019833-193019855 ATACATTTAATATTTATCTAAGG + Intronic
919481221 1:198092106-198092128 AATCAATTCTTATTTTACTAGGG - Intergenic
921002819 1:211061918-211061940 ATGCCATTAGTATTTTAATAGGG - Intronic
921274645 1:213507069-213507091 ATTGATTTATCAATTTACTAGGG - Intergenic
921566515 1:216728098-216728120 ATGCATTTGGTATCTTACCAGGG - Intronic
921720786 1:218468675-218468697 AATCCTTTATTCTTTTACTATGG + Intergenic
922116140 1:222617195-222617217 ATTAATTTACTTTTTTCCTATGG + Intergenic
923583582 1:235243180-235243202 ATGCATTTATTTTTTTATTATGG + Intronic
923808349 1:237285419-237285441 ATTCAGTTAGTATTTTGTTGAGG + Intronic
924251362 1:242136320-242136342 ATTCAGTTAGAATTTTATAAAGG + Intronic
1063089744 10:2852256-2852278 ATTTATTTAGTATTTTTTTAAGG - Intergenic
1063244870 10:4207270-4207292 GTTCATTTATTATTAAACTAAGG + Intergenic
1064480678 10:15737411-15737433 TTTCTTTTAGAATTTTAATAAGG - Intergenic
1064494592 10:15895755-15895777 ATTCATTTAGTCTATTAACAGGG - Intergenic
1065550720 10:26866146-26866168 ATTGAGTTAGTATTTTTCTGTGG + Intergenic
1067969688 10:50955204-50955226 AGTCATGTGGTATTTTACTATGG + Intergenic
1068218920 10:54018176-54018198 ATACATATAGTCTTCTACTAAGG + Intronic
1068898413 10:62234763-62234785 AATCATTTATTATTTCATTATGG - Intronic
1068935484 10:62631743-62631765 ATTTCTTTAATATTTTAATAAGG - Intronic
1069216437 10:65827130-65827152 ATTCATTTATTATTTTATTATGG + Intergenic
1069345871 10:67469277-67469299 TTTCATTTAGTATATTTTTAAGG - Intronic
1071695648 10:87866366-87866388 ATTAATTGAGAATGTTACTAAGG + Intronic
1071701757 10:87946302-87946324 ATTCATTTATTTATTTATTAAGG - Intronic
1071728792 10:88227048-88227070 ATTCATTTAGTTATTATCTATGG + Intergenic
1071864193 10:89707925-89707947 CTTCATTTATTCTTTTAATATGG + Intronic
1072428003 10:95346601-95346623 ATTTATCTAGTGTTCTACTAAGG - Intronic
1072853895 10:98926168-98926190 ATTCATTCAATAAGTTACTATGG - Intronic
1072966287 10:99975423-99975445 AATCATTTAGTATATTAATATGG + Intronic
1073127588 10:101161344-101161366 AGTCATTTGGTATTTTCCAAGGG + Intergenic
1073244068 10:102077124-102077146 ATTTTTTTTGTATTTTAGTATGG + Intergenic
1073902420 10:108238549-108238571 ACATATTTAGTATTTAACTATGG + Intergenic
1074429146 10:113378508-113378530 ATGCATTTAGTATTAAAGTAGGG - Intergenic
1074917691 10:117973229-117973251 ATGACTTTAGTACTTTACTATGG + Intergenic
1074929070 10:118104962-118104984 ACTCTTTAAGTATTTTACTAAGG + Intergenic
1077846600 11:6032054-6032076 ATTCATTAAATATTATAATAAGG + Intergenic
1078114838 11:8436634-8436656 ATTTGTACAGTATTTTACTATGG - Intronic
1078634108 11:13032989-13033011 ATGCATTTAGTAATTTAAGATGG - Intergenic
1078957997 11:16224841-16224863 AATCATATAGTAAATTACTAAGG - Intronic
1078961800 11:16283578-16283600 AATCTTTTAGTGTTTTACAAAGG - Intronic
1079779169 11:24577097-24577119 AATCATTAACAATTTTACTATGG + Intronic
1079836974 11:25347758-25347780 ATTCATTTATATTTTTATTATGG + Intergenic
1079872174 11:25812571-25812593 ATACATCTAGTATTTTAAAAAGG - Intergenic
1081315014 11:41621324-41621346 ATTCATTTAGAAGTTTTCCATGG - Intergenic
1081352282 11:42068889-42068911 ATTCATTTAATGGTTTACAATGG - Intergenic
1081778067 11:45690441-45690463 ATACATTTAATTTTTTAGTAAGG - Intergenic
1081890621 11:46539223-46539245 TTTCTTTTAATATTTTATTATGG - Intronic
1082042822 11:47700707-47700729 ATTCATGTAATATTTGACTGAGG - Intronic
1082639537 11:55640589-55640611 TTTCACTTAGTGTTTTTCTATGG - Intergenic
1083573607 11:63773300-63773322 ATTCCTTTGGGATTTTACAAGGG - Intergenic
1084082259 11:66835689-66835711 TTTCATTTAGCATGTTTCTAAGG + Intronic
1085541150 11:77270995-77271017 ATTCATTTAGCTTGTTACTCAGG - Intronic
1085654992 11:78305899-78305921 TTTTATTTAGAATTTCACTAGGG - Intronic
1085832071 11:79912084-79912106 ATTCAGTTAGTATTCCACTAAGG + Intergenic
1086193173 11:84104797-84104819 ATGCTTTTAGTATTTTACTAGGG - Intronic
1086431766 11:86743112-86743134 ATTCATTTCGGATTTGACCAAGG - Intergenic
1086486750 11:87312202-87312224 ATTGATTGTGTATTTTACTATGG + Intronic
1086565623 11:88223090-88223112 ATTCATTTAATCTTTTTCCAAGG + Intergenic
1086801503 11:91182658-91182680 TCTCATGGAGTATTTTACTAGGG + Intergenic
1086969142 11:93061605-93061627 ATACATTTAGAATATGACTAAGG - Intergenic
1087956404 11:104293195-104293217 AGTCACTTAATATTTTACTTGGG - Intergenic
1088450386 11:109975471-109975493 ATTCATTTACTATTTCACTTGGG + Intergenic
1088982903 11:114879794-114879816 TTACATTTAATATTTTTCTAAGG - Intergenic
1090353381 11:126122313-126122335 TTTCATTTTGTTTTTTAGTACGG + Intergenic
1090691143 11:129183344-129183366 ATTTATTTAGTTTTTTAAAAAGG + Intronic
1091634166 12:2184922-2184944 AGTCATTTAGTATTGAACTGGGG + Intronic
1092470919 12:8779940-8779962 ATTCATTAAGTCTTTTAAAAAGG - Intronic
1092690476 12:11103742-11103764 ATTCATTTAATATAGTCCTATGG - Intronic
1093637318 12:21486837-21486859 ATTTCTTTTGTATTTTAGTAGGG + Intronic
1094321431 12:29188245-29188267 TTTCTTTTAGTATTTTAGTGAGG + Intronic
1095769196 12:45933025-45933047 ATTCAATTGTTATTTTCCTAAGG - Intronic
1097218615 12:57433483-57433505 ATTTATTTTTTATTTTAGTATGG + Intergenic
1097476382 12:60061193-60061215 ATTTATATTTTATTTTACTAAGG - Intergenic
1098313754 12:69172582-69172604 ATTGATTTAGTATTTAACAGTGG + Intergenic
1098520359 12:71428966-71428988 ATTCATTTAGTATTTTGTTTGGG - Intronic
1099207136 12:79741864-79741886 ATACATTTAGTAGCTTAATAAGG - Intergenic
1099336150 12:81360949-81360971 ATTTATTTAGAATGTTATTAAGG + Intronic
1099702862 12:86110234-86110256 ATTCATTTATTGTTTTACAGAGG - Intronic
1099865839 12:88279612-88279634 AATGATTTGGTATCTTACTATGG - Intergenic
1099997241 12:89791814-89791836 CTGCATATAGTATTTTACAATGG - Intergenic
1100706197 12:97203031-97203053 TTTCATTTAGAGTTTTACTGAGG + Intergenic
1101300786 12:103478064-103478086 ATTTATTTCTTATGTTACTAAGG - Intronic
1104188165 12:126452387-126452409 ATTCATTTATTTTTTTAAGATGG - Intergenic
1105525333 13:21172581-21172603 ATTGATTTATTATTTTTCTGTGG - Intronic
1106572854 13:30943854-30943876 ATTCAGTTAGTATTTTGTTGAGG + Intronic
1107367457 13:39698173-39698195 ATTCATTTTTTTTTTTAATATGG - Intronic
1108791588 13:53974562-53974584 ATTGATTTTTTATTTGACTATGG - Intergenic
1109475242 13:62872819-62872841 ATTCATTTATGAATTTTCTATGG + Intergenic
1109492773 13:63125593-63125615 CTTCATTTAGTCTTTTATAAAGG - Intergenic
1109817955 13:67612111-67612133 ATTTATTTACTATTTTACATTGG + Intergenic
1109994415 13:70104855-70104877 TTCCATTCAGTATTTTACTTTGG + Intronic
1110104963 13:71661609-71661631 TTTCATTTGATATTTTATTATGG - Intronic
1110458816 13:75721020-75721042 ATTAATTTAAAATTTTAGTAAGG + Intronic
1111044970 13:82803116-82803138 ATTGCTTTTCTATTTTACTATGG - Intergenic
1111257377 13:85688459-85688481 AATCAGTTAAAATTTTACTATGG + Intergenic
1111447068 13:88360745-88360767 ATTCATTTACAATTTTCGTATGG - Intergenic
1111519004 13:89375006-89375028 TTTCACTTAATATTTTATTAGGG - Intergenic
1111641779 13:90978714-90978736 TTTCATGGAGTATTTTACTGGGG - Intergenic
1111796704 13:92929728-92929750 TTTCATTTAACATTGTACTATGG + Intergenic
1112591925 13:100771497-100771519 GTTTATTTATTATTTTAATAAGG + Intergenic
1113002049 13:105651717-105651739 ATTCATTTATTAGTTTCATATGG - Intergenic
1113109701 13:106809616-106809638 ATTCACTTAGGATTTTCCTAAGG - Intergenic
1114141102 14:19911710-19911732 ATTCATCTAGTTTTTTTCCAAGG - Intergenic
1115841314 14:37473853-37473875 AGTATTTTAGTATTTTAGTATGG - Intronic
1116627328 14:47282306-47282328 ATTTATTTAGTATTATTCCATGG - Intronic
1116835579 14:49766887-49766909 ATTAATTTTGGATTCTACTAAGG + Intergenic
1117007410 14:51435757-51435779 ATTTATTTAATATTTTAAAATGG + Intergenic
1119369219 14:74124323-74124345 ACTCATTTGGTCTTTTACAAAGG - Intronic
1120554314 14:85909845-85909867 TTTCATTCAGTGTTTTACTTTGG + Intergenic
1120702090 14:87709218-87709240 ATTCATTTTATAATTTAGTATGG + Intergenic
1120950628 14:90038461-90038483 AATCATCAAGTATTTTTCTAAGG + Intronic
1121188503 14:92000192-92000214 ATTCATTTAATTTTTAAATAGGG + Intronic
1122360034 14:101153615-101153637 TTTAATTTATTATTTTAATATGG + Intergenic
1122443234 14:101749096-101749118 ATTCATCTAATATTTTTCCAAGG + Intergenic
1123851988 15:24367168-24367190 CTTCACTTAGTATTTTCCCAAGG + Intergenic
1123957735 15:25356923-25356945 ATTACTTTTGTATTTTATTAAGG + Intronic
1123995445 15:25714934-25714956 ATTCATTTTGTTTCTTACTGTGG - Intronic
1124120045 15:26881432-26881454 ATGCATTTAGTGCTTCACTATGG + Intronic
1124160524 15:27264394-27264416 GTTCATATAGTATTTTATAAGGG - Intronic
1124195812 15:27627357-27627379 ATTTATTTGCTATTTTACTATGG - Intergenic
1126030250 15:44489923-44489945 ATTCAATTAGTATATTGGTATGG + Intronic
1126631805 15:50743822-50743844 AATCATTTTGTATATTACTTAGG - Intronic
1126844971 15:52751048-52751070 ACTCATTATGTATTTTAATAGGG - Intergenic
1126984205 15:54284190-54284212 ATTTATTTGATATTTTAATAAGG - Intronic
1127208867 15:56750052-56750074 ATTCGATTGCTATTTTACTAAGG - Intronic
1127580626 15:60336188-60336210 ATTCAGTTATTATGTCACTATGG - Intergenic
1127853299 15:62934234-62934256 AGTCATTTTGTATTTTTCTAGGG + Intergenic
1130098305 15:80872461-80872483 ACTCATATAGAAGTTTACTATGG - Intronic
1131839722 15:96424234-96424256 ATTTACTTAGTATTTTAAAATGG + Intergenic
1131907473 15:97158930-97158952 ATTCATTTACTATTTTGCATGGG + Intergenic
1132360896 15:101214458-101214480 ATTCAGTTATTATTTTAAGATGG - Intronic
1133387441 16:5381341-5381363 ATTTATTTAGTATTTACTTAGGG + Intergenic
1135225406 16:20652174-20652196 ATTAATTTAGTAGTTTACCTAGG - Intronic
1137465215 16:48701999-48702021 ATTTATTTAGGATTTTGCTTTGG + Intergenic
1138290306 16:55841024-55841046 ATTTATTGAGTATTATACTATGG + Intergenic
1138318834 16:56093728-56093750 ATTCAGTTTCTATTATACTAAGG + Intergenic
1138786886 16:59857208-59857230 ATTAATTTAGTAGTTTACCTAGG + Intergenic
1143226858 17:5312486-5312508 CATCATATAGTATTTTACTATGG - Intronic
1143889183 17:10089241-10089263 CTTCATTTAGTTTTTCACTCTGG - Intronic
1145098694 17:20054890-20054912 ATTCTTTTTTTATTTTACTGTGG + Intronic
1145399707 17:22521445-22521467 ATGCATTTGGTATTTTAATCTGG + Intergenic
1145832912 17:27931755-27931777 ATTCCTGTAGTAGTTTGCTATGG - Intergenic
1148012603 17:44495714-44495736 ATTGGTTTAATATTGTACTAGGG - Intronic
1150021783 17:61622747-61622769 ATTTATTGATTTTTTTACTATGG + Intergenic
1150412622 17:64959185-64959207 AATTATTTAGTCTTTTTCTAAGG - Intergenic
1150669367 17:67177412-67177434 ATTTGTTTAATATTTTATTAAGG - Intronic
1150799267 17:68266282-68266304 AATTATTTAGTCTTTTTCTAAGG + Intronic
1153526160 18:5996819-5996841 ATTAATTTAGTATCTAAATAGGG - Intronic
1153598401 18:6753168-6753190 ATTTATTTTGTATTTTTTTAAGG + Intronic
1153855507 18:9141397-9141419 ACTCATTTAGGATTTTCATAAGG + Intronic
1153962700 18:10153053-10153075 TTTCATTTAGTTATTTGCTATGG - Intergenic
1155267676 18:24109660-24109682 TTTCATTTAGTGCTTTACTCTGG - Intronic
1155551304 18:26968635-26968657 ATTCATTAAATATTCTACAATGG + Intronic
1155643693 18:28051352-28051374 ATCTATTTAGTATTTTCCCAAGG - Intronic
1155703062 18:28773293-28773315 ATTCATTCTGTATTTTATTCAGG + Intergenic
1155866255 18:30968918-30968940 ATTAATTAATTATTTTATTAAGG + Intergenic
1155943292 18:31821249-31821271 ATTCATTTAGTTTTTGAGCATGG + Intergenic
1156891815 18:42198940-42198962 ATTCCTATGGTATTTTATTATGG - Intergenic
1158841099 18:61388418-61388440 ACTGATTTCTTATTTTACTATGG + Intronic
1159407121 18:68018556-68018578 ATCCATTTATTAATTTATTATGG - Intergenic
1159623430 18:70666709-70666731 ATTCAGTTGGAATTTTGCTAGGG + Intergenic
1161157954 19:2743830-2743852 ATTCATGGTGTTTTTTACTATGG - Intergenic
1162171264 19:8790948-8790970 ATTCAATTCTTTTTTTACTATGG + Intergenic
1163951341 19:20590262-20590284 ATTCATTCAGTATATTAATATGG - Intronic
1163965281 19:20740830-20740852 ATTCATTCAGTGTATTAATATGG + Intronic
1164577625 19:29414977-29414999 ATTCATTTACTTATTGACTATGG + Intergenic
1167653558 19:50748126-50748148 ATACATTTAGAATTTCACCATGG + Intergenic
925354571 2:3228986-3229008 ATTAATTCAGCATTTGACTAGGG - Intronic
925620618 2:5788912-5788934 ATTTTTTAAATATTTTACTATGG - Intergenic
926428569 2:12763021-12763043 ATTCATTTGTTATTTTTGTAAGG - Intergenic
926446758 2:12952211-12952233 TTTCTTTTAGTATTTTAAAAAGG + Intergenic
927395593 2:22646987-22647009 ATTCATTAAGTATTGTATTAGGG - Intergenic
927397950 2:22676209-22676231 GTTCTTTTATTATTATACTAAGG - Intergenic
928248382 2:29652295-29652317 AATCATTTTTTATTTCACTATGG - Intronic
928334014 2:30380331-30380353 ATTTATTTAGCATTTACCTATGG + Intergenic
928416771 2:31099679-31099701 GATCATTTAGTATTTGACAAAGG - Intronic
928524539 2:32126356-32126378 ATTCATTTAGTATTTTTTGGTGG + Intronic
928559743 2:32467948-32467970 ATCCCATTAGGATTTTACTATGG + Exonic
928947319 2:36783172-36783194 ATTAATTTATTATTTTTCTCAGG + Intronic
929154154 2:38774381-38774403 ATTCAATTAGTATATTAGAAAGG - Intronic
930344017 2:50155339-50155361 ATTCATTTATTATTTTGCTTGGG + Intronic
930451777 2:51550049-51550071 ATTCATTAAGAGTTTTCCTATGG - Intergenic
930472828 2:51841794-51841816 ATTCATATAGTACTGTACCAGGG + Intergenic
930870032 2:56161163-56161185 ATATATTTTGTATTTTTCTAGGG - Intergenic
930890499 2:56380619-56380641 ATTTATTTATTTTTTTACTGTGG - Intronic
931181609 2:59907181-59907203 ATTCTTTAAGTGATTTACTAAGG - Intergenic
931826189 2:66003549-66003571 ATATATTTAGTATTTTACACAGG + Intergenic
931945734 2:67304878-67304900 AGTCATTTAGTTTATTACAAAGG + Intergenic
932952611 2:76311574-76311596 TTTTATTTACTATTTTAATAAGG - Intergenic
933169970 2:79114333-79114355 ATTTATTTATTTATTTACTAAGG + Intergenic
933522575 2:83391952-83391974 ATTCTCTTAGTATTTTCCTGGGG - Intergenic
934817845 2:97345569-97345591 ATTTATTTAATATTTTTGTAGGG + Intergenic
934819851 2:97362915-97362937 ATTTATTTAATATTTTTGTAGGG - Intergenic
936168544 2:110146483-110146505 ATTCTTTCAGTAATTTCCTATGG - Intronic
936579796 2:113688466-113688488 ATTTATTTATTATTTTATTTTGG - Intergenic
936586190 2:113760161-113760183 AGTCATTTATAATTTTATTAGGG - Intergenic
938650215 2:133375268-133375290 ATTCTTTTGGTATTCTTCTAGGG + Intronic
939425803 2:142035011-142035033 ATTCATTTACTAATTTAAAATGG + Intronic
939809761 2:146816413-146816435 ATTCAATTAATTTTTTACAAAGG - Intergenic
939913540 2:148012306-148012328 AGCCAATTAGTTTTTTACTAAGG + Intronic
939928788 2:148206268-148206290 TATCATTTAACATTTTACTAAGG + Intronic
940899489 2:159113397-159113419 ATTAATTTAGTACTCTTCTAAGG - Intronic
941019371 2:160391605-160391627 ATGCAATTACTATTTTACCATGG + Intronic
941094711 2:161225013-161225035 ATTTATTTTGTATTTTTTTAAGG - Intronic
941225505 2:162842045-162842067 AGTCATTTAGTATTTACATATGG + Intergenic
941837937 2:170046898-170046920 AAACAGTTATTATTTTACTATGG - Intronic
941854501 2:170217135-170217157 ATTCATTTATGTGTTTACTATGG + Intronic
942666484 2:178324775-178324797 ATTTATTTATGTTTTTACTATGG - Intronic
942790992 2:179760420-179760442 ATTCATACAGTATGTTACTTTGG + Intronic
942809807 2:179984779-179984801 ATTATTTTAGTATTTTATAAAGG - Intronic
943381049 2:187148600-187148622 AATCATGTATTATTTTGCTATGG + Intergenic
943935871 2:193916623-193916645 AATCTTTTAGTAATTGACTACGG + Intergenic
943983776 2:194592481-194592503 ATTGATTTAGAAATTTATTAAGG + Intergenic
944231257 2:197395087-197395109 TTTCATTTAGTAATTTTCAATGG + Intronic
944297816 2:198086780-198086802 ATTGATTCAGTTTTGTACTAAGG - Intronic
944309045 2:198212145-198212167 TTTCAATTTGTATTTTACTGTGG + Intronic
944381537 2:199116371-199116393 ATTTATTTAATAATTTACTGAGG + Intergenic
945190468 2:207182319-207182341 AGGCATTTAATATTTTACAATGG + Intergenic
945428172 2:209733538-209733560 ATTCCATCAGTATTTTATTAAGG + Exonic
945522486 2:210845500-210845522 ATCTATGTAGTATTTGACTAGGG - Intergenic
945714263 2:213337872-213337894 TCTCATGTAGTATCTTACTAGGG - Intronic
946058260 2:216919740-216919762 ATTCACTTTGTATTTTCCAAAGG + Intergenic
946708579 2:222484010-222484032 ATTTACTTAATATTTAACTAAGG - Intronic
947146601 2:227072651-227072673 ATTCATTTAGTATTTTGTTGAGG - Intronic
947562338 2:231167425-231167447 AATCATTTAGTTTTCTACTGTGG - Intronic
947884250 2:233552619-233552641 ATTTATTTTGTATTTCACTTTGG - Intronic
948544228 2:238715019-238715041 ACTCATTTATTATTTGTCTATGG + Intergenic
948579718 2:238977671-238977693 TTTCATTTAGTATGTTTCCAAGG - Intergenic
1169015665 20:2290760-2290782 ATGCATTTTGTCTTTTACAAGGG + Intergenic
1169397627 20:5247700-5247722 ATTTATTTAGTATTTTGTTGAGG + Intergenic
1169416949 20:5425533-5425555 ATTAATCTGGTATTTTACTTGGG - Intergenic
1169484526 20:6016609-6016631 TTTGATGTAGTATTTTACAAAGG + Intronic
1169561998 20:6811641-6811663 ATTCACTTAGTGTTTTTTTATGG - Intergenic
1169563623 20:6828740-6828762 ATTCCTTTACTATCTTTCTATGG - Intergenic
1169725725 20:8727452-8727474 GTTCATTTGGTTTTTTAATAAGG + Intronic
1170162107 20:13323699-13323721 ATTCTTTTAGTAATTAACTCTGG - Intergenic
1170233662 20:14078380-14078402 ATTCATTTAGAATTTGATTTTGG - Intronic
1170305682 20:14935237-14935259 ATACATTTAGAATCTTTCTAAGG - Intronic
1170416345 20:16146879-16146901 ATCCATTTAATATTTTACCATGG + Intergenic
1171110804 20:22480530-22480552 AGTAATTTAGTAATTTAGTAAGG + Intergenic
1172055025 20:32148599-32148621 ATTCTTCTATTATTTTTCTAAGG + Intronic
1174570834 20:51500208-51500230 ATTCATGTATCATTTTACTGAGG - Intronic
1174866902 20:54145873-54145895 ATTCACGTATTATTTTACTTAGG + Intergenic
1175043887 20:56084009-56084031 ATTCTTGTAATATTTTACTTAGG + Intergenic
1175345555 20:58271151-58271173 TTTTCTTTAGCATTTTACTATGG - Intergenic
1177004812 21:15658434-15658456 ATTTCTTAACTATTTTACTAAGG + Intergenic
1177378278 21:20302564-20302586 ATTAATTTTTTATTTTACCAAGG - Intergenic
1177410942 21:20730055-20730077 TTTCATTTAGCATTTAACTTAGG + Intergenic
1177513321 21:22118044-22118066 AAACATTTGGTATGTTACTAAGG + Intergenic
1181505346 22:23352485-23352507 ATTTATTGAGTATTACACTATGG - Intergenic
1181996167 22:26884474-26884496 ATTTGTTTTGTATTTTACTATGG + Intergenic
1182883133 22:33751121-33751143 ATTCACTAAGTATTTCACTTAGG - Intronic
1185295644 22:50052478-50052500 ATTCATTTAGTACGTTCCTTTGG - Intronic
949462675 3:4309855-4309877 ATACAGTTATTATTTAACTATGG + Intronic
950603141 3:14053585-14053607 ATTCATGGAGTATTTCCCTATGG - Intronic
950619404 3:14191738-14191760 ATTCATTGATTATTTTTTTAGGG + Intronic
951599585 3:24358818-24358840 ATTCCCTTAATATTTTACTGAGG + Intronic
951929236 3:27945189-27945211 ATTCATCTGGTATTTAACCAGGG - Intergenic
952089827 3:29871483-29871505 TTTCATTTACCATTATACTAAGG + Intronic
952095617 3:29949086-29949108 AATCATTAAGAATTTTCCTATGG + Intronic
954236497 3:49261096-49261118 ATTCCATTAGTATTTGACTGTGG + Intergenic
954251303 3:49369564-49369586 ATTTCTTTCGTATTTTAGTAGGG - Intronic
955033646 3:55244940-55244962 TTTCATTTTGTATTTCAGTAGGG + Intergenic
955985610 3:64571105-64571127 ATTAATTTAGTAATCTACTGTGG + Intronic
956054130 3:65280410-65280432 TTTCATTTAGAACTTTTCTATGG + Intergenic
956538031 3:70300974-70300996 ATTCATTTAGTAATTTCCCTTGG + Intergenic
956546018 3:70403586-70403608 ATTCATTTACTTATTTTCTATGG + Intergenic
956601326 3:71025790-71025812 ATTGATTCAGTAGTTTACTCTGG - Intronic
957180154 3:76867262-76867284 ATTCGTTTATTATTTTAGTAAGG + Intronic
957328755 3:78731720-78731742 ATACATTTGTTATTTTAGTATGG - Intronic
957573902 3:81985046-81985068 ATTCATTGAGTCATTTAATATGG - Intergenic
957921446 3:86753685-86753707 ATTCAGTTAGTATTTTGTTGAGG + Intergenic
958444089 3:94193855-94193877 ATACATTTAGAATTTTAGGATGG + Intergenic
958468617 3:94489796-94489818 CTTCATTTAGTATTTTAAATGGG - Intergenic
958535950 3:95403248-95403270 ATTAATTTTGTATATTAATATGG - Intergenic
958537928 3:95427805-95427827 ATTTATTTATCATTCTACTAAGG - Intergenic
958702986 3:97616932-97616954 TCTCATTGAGTATTTTACTGGGG - Intronic
958887715 3:99746183-99746205 ATACATTAATGATTTTACTAAGG + Intronic
958889459 3:99767294-99767316 TTTCATTTAATATTTAACTTTGG + Intronic
959117142 3:102191733-102191755 ATTCATTTATTAATTTAAAATGG - Intronic
959468352 3:106718480-106718502 ATTCTTTTATTATTTTAAAAAGG + Intergenic
959472475 3:106769033-106769055 ATTCATTTAAAGTTTTAATAAGG - Intergenic
959551243 3:107661273-107661295 ATTTCTTTAATATTCTACTAGGG + Intronic
960092054 3:113650718-113650740 AATCATTTTGTATTTTAAGAAGG + Exonic
960468243 3:118025985-118026007 ATTCAGTTAGTATTTTGTTGAGG + Intergenic
960655855 3:120003535-120003557 ATTCAGTTAGTATTTTAGAAAGG - Intronic
961953478 3:130774809-130774831 ACTAGTTTAATATTTTACTAAGG - Intergenic
962429936 3:135309675-135309697 ATTCTTTTAAAATTTTATTAAGG + Intergenic
963018845 3:140851955-140851977 ATTCATTTACTTTTTTATTGAGG + Intergenic
963453587 3:145516061-145516083 TTTGATTTAATATTTTTCTAGGG - Intergenic
964192718 3:154023638-154023660 ATTCAGTTATTTTTTTACTTAGG + Intergenic
964203388 3:154143616-154143638 TTACATTTAATATTTTAATAAGG - Intronic
964257680 3:154795530-154795552 ATTAATTAAATATTTTAATATGG + Intergenic
964312271 3:155407104-155407126 ATTCAGTTAGTATTCAACAAAGG + Intronic
964810825 3:160662557-160662579 ATTGATTTTGAATTTTTCTATGG - Intergenic
965206426 3:165723585-165723607 ATTCCTTTAGTAGTTTATTTAGG + Intergenic
965343017 3:167513103-167513125 TTTCATGTAGTATCTTACTGGGG - Intronic
967132297 3:186483196-186483218 TTTCATTTAGGATTTTATTTTGG - Intergenic
967592116 3:191290196-191290218 AAGAATTTAGTATTTTATTAAGG - Intronic
967710212 3:192697929-192697951 ATTAATTTAGAATTTTACTTAGG - Intronic
970063053 4:12057335-12057357 GTTCCTTTACTATTTTTCTAAGG + Intergenic
970856498 4:20655138-20655160 ATTCAGTTAGTATTTTGTTGAGG - Intergenic
970996698 4:22275994-22276016 GTTAATTTTGTATATTACTAAGG + Intergenic
971414954 4:26416564-26416586 ATTCACTTAGAATTTAGCTATGG + Intronic
971521551 4:27558068-27558090 ATTCCTCTAATATTTTACAAAGG + Intergenic
971596675 4:28538269-28538291 ATTCATTTAGTAAATAATTACGG + Intergenic
971599809 4:28577822-28577844 GTTGATTTAGAATTTTAATAAGG - Intergenic
972018456 4:34277094-34277116 ATTCAGTTAGTATTTTGTTGAGG + Intergenic
972212276 4:36853334-36853356 ATTCATTTAGTTTTTTTCCTTGG - Intergenic
972444784 4:39133051-39133073 ATTAAGTTATTATTTTATTATGG - Intergenic
972805765 4:42528311-42528333 TTTGATTTACTATTTTTCTAGGG - Intronic
972884915 4:43473540-43473562 ATGCATTTATTATTGTACTGAGG + Intergenic
973029729 4:45322273-45322295 ATTTATTTATTTTTTTAATACGG + Intergenic
973044241 4:45515623-45515645 ATTCATTTATTTATTTATTATGG + Intergenic
974153137 4:58036164-58036186 ATTCATTTTGTATAATACTTTGG - Intergenic
974224003 4:59015250-59015272 ATCCAGTTATTATTTTATTAGGG + Intergenic
974320310 4:60338865-60338887 TTTTACTTAGAATTTTACTATGG + Intergenic
974429110 4:61773284-61773306 TTTGATTTAGTATATTACTAAGG - Intronic
974444173 4:61957664-61957686 ATTAATTTAGTTTTTTCCTAAGG - Intronic
975062509 4:70019846-70019868 ATACATTTAGTAAATTAGTAGGG + Intergenic
975191301 4:71466135-71466157 CTTCAGTTAGTATTTTAGTAAGG + Intronic
975375233 4:73636120-73636142 ATTCAGTTAGTATTTTGTTGAGG - Intergenic
975582735 4:75921438-75921460 ATTCATTTATTATTTAAACAGGG + Intronic
976118789 4:81757606-81757628 CTTCATTTAGCATTATACAAAGG + Intronic
976240516 4:82951303-82951325 ATTCATTTGCTATTTTTCCATGG + Intronic
976376556 4:84352247-84352269 AATAATTGAGTAATTTACTAAGG - Intergenic
976772532 4:88669276-88669298 ATTCTTTAAGTATTTCAGTATGG + Intronic
976986048 4:91299476-91299498 ATTTATTTAGTACTTACCTATGG + Intronic
977375055 4:96191916-96191938 ATTCATTTAATATTTTGTTGAGG + Intergenic
977430636 4:96927187-96927209 TTTGATTTACTATTTTTCTAGGG - Intergenic
978040140 4:104050360-104050382 ATACATTTTGTATTTTATTCAGG - Intergenic
978332085 4:107624497-107624519 ATTCATTTATTAATTTCTTATGG - Intronic
978480717 4:109187309-109187331 ATTCATTAAGCATTTTAAGATGG + Intronic
978509205 4:109497267-109497289 TTTCATTTCGTATTTTATTTGGG + Intronic
978543992 4:109850991-109851013 ATTGATTTATTATTTTAACAGGG + Intronic
978855227 4:113386927-113386949 ATTAATGTAGTAGTTTCCTAGGG + Intergenic
979064496 4:116111575-116111597 ATTCGTTTAGTATAATATTATGG - Intergenic
979363050 4:119787161-119787183 ATTCATTTTATAAGTTACTAAGG + Intergenic
979421534 4:120510359-120510381 ATTCCTTTAATCTTTTACCAAGG - Intergenic
980023483 4:127737007-127737029 ATGCATTCAGAATTTTACTTAGG + Intronic
980302109 4:131008817-131008839 ATTAATTTATTGTTTTACTTGGG + Intergenic
981318957 4:143369407-143369429 ATTCATTTAGTTTTTCACTCTGG + Intronic
981923513 4:150113139-150113161 ATTCAGTTAGTATTTTGTTGAGG + Intronic
982064266 4:151639383-151639405 ATTCATTTGGCAGTTTAATAGGG + Intronic
982284115 4:153716458-153716480 ATGCATTTAGAACTTTACTTTGG + Intronic
982526124 4:156481780-156481802 ATTCATTCAGTCTTTTCTTAAGG + Intergenic
982757950 4:159246770-159246792 ATTTATTCAGTTTTTTACTGAGG + Intronic
984047654 4:174821346-174821368 ATTTATTTTGAATTTTACTAGGG - Intronic
984157684 4:176211509-176211531 TTTCATTGAGTCTTTTAATAAGG - Intergenic
984663115 4:182395450-182395472 ATTAATTTAGTACTTTCCTTTGG - Intronic
985305128 4:188531239-188531261 ATTCATGTATTAGTTTGCTAAGG - Intergenic
985311796 4:188609632-188609654 ATCCAGTTTATATTTTACTATGG - Intergenic
985875132 5:2588563-2588585 ATTTATTATGTCTTTTACTAGGG + Intergenic
986754796 5:10825250-10825272 ATTTATTTGGTATTTTAATAGGG - Intergenic
986845494 5:11747629-11747651 ATTTGTTTAGGATATTACTAGGG - Intronic
986948403 5:13051856-13051878 ATACATTTAATATTTTGCTTGGG + Intergenic
987134795 5:14890472-14890494 ATTTATTTATTATTTTACAGAGG - Intergenic
987457139 5:18161969-18161991 ATTCATTGAGTATTGTGTTATGG + Intergenic
988115207 5:26878608-26878630 ATTCATTTAGTTTGCTAGTAAGG + Intergenic
988261386 5:28890692-28890714 ATACATATAGTAGTTTATTAAGG + Intergenic
989770035 5:45133476-45133498 GTTGATTTAATATTTTACTCTGG - Intergenic
989807944 5:45634877-45634899 ATTCATTTTGGATGATACTAAGG - Intronic
990092350 5:52068408-52068430 ATTCATTTATTATTTTTTGATGG - Intronic
990591120 5:57266180-57266202 ATTGTTTTAATATTTAACTATGG + Intergenic
991331178 5:65494058-65494080 ATTCATTTATTATTTTATGCAGG + Intergenic
992009445 5:72512136-72512158 AATCATTAAAGATTTTACTAAGG + Intergenic
992293449 5:75304101-75304123 ATTCAGTTAGATTTTTACTAGGG - Intergenic
992723504 5:79583335-79583357 ATTTATTTACTATGTTGCTAAGG - Intergenic
993236520 5:85317296-85317318 ATTCAATAAATATTTTACTGTGG + Intergenic
993420818 5:87699369-87699391 TCTCATGGAGTATTTTACTAGGG + Intergenic
993540404 5:89142730-89142752 ATTTATTTACTATTCTGCTAAGG - Intergenic
994038670 5:95232214-95232236 ATTAATTTAGTATTTTTTGATGG - Intronic
994949100 5:106433838-106433860 ATTAATTTTTTATATTACTAAGG - Intergenic
995069349 5:107900195-107900217 ATTCAGTTGGTCTTTTAGTAAGG + Intronic
995494780 5:112729854-112729876 ATATATTTAGTATCTTACAAGGG + Intronic
995635046 5:114178611-114178633 ATTCATTTAGCCTTTTAGTGGGG + Intergenic
995772242 5:115684106-115684128 CTTCATTTTGAATATTACTATGG - Intergenic
996627996 5:125593345-125593367 ACTCATTTAGTATTATAGTTTGG - Intergenic
997818132 5:137037500-137037522 ATTCATTTTGTATTTTGTTAAGG + Intronic
997942741 5:138173095-138173117 ATTCTTATACTATTTTTCTATGG + Intronic
999212714 5:149904321-149904343 TTTCATTTATTATTCTACTTTGG - Intronic
999248900 5:150169942-150169964 ATTGGTTTAGAATTTTCCTATGG + Intronic
1000494277 5:161959642-161959664 ATTGCTTTAGTGTATTACTATGG + Intergenic
1000666760 5:164007288-164007310 ATTCATTTTACATTTTATTAAGG + Intergenic
1000693523 5:164351467-164351489 ATTCATTGAGGATTTCAGTAGGG + Intergenic
1000729613 5:164816780-164816802 ATTAATAAAGTATTTTAGTAAGG + Intergenic
1000882336 5:166712741-166712763 ATTCATTTAGCATTTTTCTAAGG - Intergenic
1001356857 5:171035337-171035359 ATTCATTTAAAAAATTACTAAGG - Intronic
1003010748 6:2425022-2425044 TTTCTTTTAGTATATTTCTAAGG + Intergenic
1005486207 6:26302507-26302529 ATTCATTTAATAGTTTTCTGTGG - Intergenic
1005595024 6:27370778-27370800 ATTCATTTATTTATTTACTTTGG + Intergenic
1006265688 6:32921044-32921066 ATTTAGTTAATATTTTACTTGGG - Intergenic
1007577243 6:42933214-42933236 AGGCATTAAGTATTTTCCTAGGG + Intronic
1008403280 6:51089603-51089625 TTTCATTTAGTATTTATTTAGGG + Intergenic
1008654268 6:53595617-53595639 ATTCACTTTGAATCTTACTATGG + Intronic
1008974214 6:57405497-57405519 ATTAATACAGTATTTTACTTTGG - Intronic
1009163103 6:60307020-60307042 ATTAATACAGTATTTTACTTTGG - Intergenic
1009557406 6:65191032-65191054 ATTCATGAAGAATTTTGCTAAGG - Intronic
1009882327 6:69584151-69584173 ATTCGTTTAGTATTAAACTGAGG - Intergenic
1010536015 6:77031591-77031613 ATTTATTTAGTAATTTAACAGGG - Intergenic
1010935832 6:81860281-81860303 ATTCATACAGTATTTTTTTAAGG + Intergenic
1010973321 6:82286219-82286241 CTTCTTTTACAATTTTACTAGGG - Intergenic
1012634899 6:101525631-101525653 ATTCATATAGTTTTATACTTGGG + Intronic
1012808667 6:103929243-103929265 ATTTCTTGAGTAATTTACTATGG - Intergenic
1012813919 6:103997831-103997853 ATTCATTTAGTGCTATACTAAGG + Intergenic
1014303389 6:119711445-119711467 ATTCATTTAGTCCCTTAATAAGG + Intergenic
1015221226 6:130805842-130805864 TTTCATTTCTTATTTTAGTAAGG + Intergenic
1015413811 6:132925388-132925410 ATTCATCAAGTATTTTAGGATGG + Intergenic
1015673219 6:135715312-135715334 ACTCATTTAGTATGTAACAAAGG + Intergenic
1015862700 6:137697359-137697381 GTTCATTCAGTATTTTAACATGG - Intergenic
1016121699 6:140350759-140350781 ATTCCTTCAATATTGTACTAGGG + Intergenic
1016147504 6:140694136-140694158 AGACATTTAGCCTTTTACTAGGG - Intergenic
1016198723 6:141380176-141380198 TTTCATTTAGCATTTAACAATGG - Intergenic
1016684213 6:146863251-146863273 ATTCAATTAGCCTTTTCCTAAGG + Intergenic
1017257212 6:152347356-152347378 TTTCATTTAATATATAACTAAGG - Intronic
1018112943 6:160554064-160554086 ATCCAGTGAGTATTTTATTAAGG + Intronic
1018220860 6:161578005-161578027 ATTCATTTATGATTTCTCTATGG - Intronic
1018360208 6:163060196-163060218 TTAAATTTTGTATTTTACTATGG - Intronic
1018459855 6:163987579-163987601 ATTCATTTAATTTTTTAAGATGG + Intergenic
1018833535 6:167465288-167465310 ATTTATTTATTATTATACTTTGG - Intergenic
1019006113 6:168797975-168797997 ATTTATTTAATATTATCCTAAGG - Intergenic
1019851897 7:3567811-3567833 ATTCATTTATTTTTCTTCTAAGG + Intronic
1019853029 7:3578259-3578281 TTTCATTAAGGATTTTATTAAGG + Intronic
1021063313 7:16141170-16141192 ATTCATTTATGATTTTTCTATGG + Intronic
1021191589 7:17626515-17626537 AATGATTAAGTAATTTACTAGGG - Intergenic
1021275001 7:18639663-18639685 AATCATTTAATATTTGCCTATGG - Intronic
1021378919 7:19942862-19942884 ATCCATATAGTATTTTCCTTTGG + Intergenic
1021385707 7:20027442-20027464 ATTCATTTTGTAGTGTAATAGGG + Intergenic
1021516486 7:21493474-21493496 CTTCATTTTGTAGTTTCCTAAGG - Intronic
1022304107 7:29130120-29130142 ATTCATGTATTAGTTTCCTAGGG - Intronic
1023242803 7:38166547-38166569 ATCCATTTAGTTTTTATCTATGG - Intergenic
1023620986 7:42072350-42072372 ATTCATTTTGGATTTTTCTTGGG - Intronic
1024110342 7:46139578-46139600 ATTCTATTAGTATTTTGTTAAGG + Intergenic
1024733905 7:52282653-52282675 ATTCAATTAGTATTTTTCCAAGG - Intergenic
1024912384 7:54459778-54459800 AATCATTTGGTACTTTAGTAGGG + Intergenic
1024938218 7:54734353-54734375 ATTCATTTAGTATTCTAGTATGG - Intergenic
1026543538 7:71301644-71301666 ACTCATTTAGTACTTTAATTTGG + Intronic
1027621400 7:80491116-80491138 ATTAATTCAGTATCTTCCTAAGG - Intronic
1027893310 7:84006232-84006254 ATACATTTAATTTTTTACTATGG + Intronic
1027955090 7:84867441-84867463 TTTCATTAAGTTTTTTTCTAAGG - Intergenic
1028309705 7:89316250-89316272 ATTCTTTTAGAATTTTATTAGGG - Intronic
1028892892 7:96008577-96008599 AATCATTTAATTTTCTACTATGG - Intronic
1029063618 7:97825403-97825425 ATTCATTTATTTTTTTAAGATGG - Intergenic
1029836603 7:103318764-103318786 ATTCCTTGAGTATTTTCATAGGG - Intronic
1030457592 7:109794095-109794117 TTTGATTTACTATTTTTCTAGGG + Intergenic
1030730639 7:112983727-112983749 ATTCAGGAAGTATTTTACTTGGG + Intergenic
1031042892 7:116857172-116857194 ATTTATTGAGACTTTTACTAAGG + Intronic
1031164150 7:118207815-118207837 ATTTATTCAGTGTTTTACTCTGG - Intergenic
1031198083 7:118642078-118642100 ATTAATTTAGTATTTCACATTGG + Intergenic
1031552803 7:123135356-123135378 AGTCATTTATTTTATTACTATGG + Intronic
1033186841 7:139234362-139234384 GTTCATTTAGTATTTAAGAAGGG - Intronic
1036466649 8:9003674-9003696 ATTCATTCAATCTTATACTATGG - Intronic
1039383782 8:37112002-37112024 ATTCATGCAGTAGTTTGCTAAGG - Intergenic
1040069348 8:43177580-43177602 AGTAATTTAGTAATTTAGTATGG + Intronic
1040669178 8:49666699-49666721 AGTAATTTTCTATTTTACTATGG - Intergenic
1041079763 8:54205138-54205160 GTTCATCTAGTATGTGACTAAGG + Intergenic
1041223515 8:55675248-55675270 TTTCATTTTGTATATTGCTAAGG + Intergenic
1042665086 8:71195625-71195647 ATTCATTTAGTAATTCATTATGG + Intergenic
1044288804 8:90443074-90443096 ATGTATATAGTATTTTATTAAGG + Intergenic
1044534901 8:93347205-93347227 AGTCATGTAGTATGTTTCTATGG + Intergenic
1044811908 8:96071649-96071671 ATTCATCTAATATTTTTTTAAGG - Intergenic
1046326147 8:112649490-112649512 ATCCATATATTATTTAACTATGG - Intronic
1046423326 8:114012886-114012908 TTTCATTTAGTATTTTCAGATGG + Intergenic
1046498490 8:115044668-115044690 ATTTGTTTAGTATTTTGTTAAGG - Intergenic
1047388002 8:124427261-124427283 ATGCATGTAGTAGTTTCCTAAGG + Intergenic
1047737287 8:127777166-127777188 ATTTATTTATTATTTTAAGATGG + Intergenic
1048031363 8:130636349-130636371 ATTCATTTATTAATTTACTGAGG - Intergenic
1048277945 8:133081292-133081314 CTTCATTTATTCTTTTACTGAGG - Intronic
1048628691 8:136216226-136216248 ATTTATTGAGTATTGGACTATGG + Intergenic
1050114886 9:2253598-2253620 TTTAATTTGGTATTTTACTCAGG + Intergenic
1050964214 9:11777746-11777768 ATTTAATTAGTATTTTACATTGG + Intergenic
1051049826 9:12918474-12918496 ATTTATTAAGTATTTGACCAAGG - Intergenic
1051215960 9:14797834-14797856 AATAATTTAGTATTTGATTAAGG + Intronic
1051391614 9:16571120-16571142 ATTCATTTAGTCTCTGACTGAGG + Intronic
1051595448 9:18820191-18820213 ATTCATTTAGCAGTTTTTTATGG + Intronic
1052193764 9:25687375-25687397 ATTTATTTAGTCTTTTGATATGG + Intergenic
1052480855 9:29023880-29023902 ATACATATTATATTTTACTAAGG - Intergenic
1052523007 9:29574170-29574192 ATTCATTCATTCTTTTAATAAGG + Intergenic
1052647056 9:31250156-31250178 ATTCATTTGTTATTTTTCGATGG - Intergenic
1053118808 9:35529797-35529819 ATTTATTAAGCACTTTACTAAGG + Intronic
1053176922 9:35932742-35932764 ATTCATTTCTTTTTTTACCATGG + Intergenic
1053479361 9:38404552-38404574 CTTCATTTAGTCTTGTACTGAGG + Intergenic
1054741947 9:68814975-68814997 ATTCATTTAGTTTTTTCCTGTGG - Intronic
1056026429 9:82501532-82501554 ATTCTTTTGGTAATTTTCTATGG - Intergenic
1056095189 9:83245609-83245631 ATTTTTTAAGTATTTTACAATGG + Exonic
1056832405 9:89927883-89927905 CTTCATTTAGTGTTATCCTAAGG - Intergenic
1057301126 9:93883659-93883681 AGACATTTAGAATTTTATTAGGG - Intergenic
1057393097 9:94655436-94655458 ATGCATCGAATATTTTACTACGG - Intergenic
1057742599 9:97725165-97725187 TTTCTTTTAGTCTTTTATTATGG - Intergenic
1058040726 9:100298702-100298724 ATTCATTTAGTTTTTTGATGGGG + Intronic
1058862504 9:109129484-109129506 ATTTATTTATTATTTTTTTAGGG - Intergenic
1059012348 9:110476078-110476100 ATTCATCAAGTATTTTAGGATGG - Intronic
1059033296 9:110724689-110724711 ATTCATCTTGTTTTTTAATATGG + Intronic
1059234829 9:112752064-112752086 ATTCATTTAGTATTTTACTAGGG - Intronic
1059902970 9:118949204-118949226 ATTCACTGAGTTTTTTGCTAAGG - Intergenic
1060103677 9:120860613-120860635 GGTCATTTAGTATTTTCCTGAGG - Intronic
1186322263 X:8441214-8441236 ATTCATTTAGGTTTTTAGCATGG - Intergenic
1186365326 X:8886507-8886529 CTTCATTGAGTACTTTACTGCGG + Intergenic
1187089069 X:16075053-16075075 ATTCATTTACTACTTTACAAGGG + Intergenic
1187763241 X:22610405-22610427 ATTCATCTAATTTTTTTCTAAGG - Intergenic
1188254525 X:27944459-27944481 ATTAATTTAGTGTTTTATTTTGG + Intergenic
1188319626 X:28720577-28720599 AGTCATTTTGTATTTTTATATGG - Intronic
1191768706 X:64732217-64732239 ACCCCTTTAGTATTTTATTATGG + Intergenic
1192682428 X:73266029-73266051 ATTCATTTAATATTTTCACATGG - Intergenic
1192889814 X:75377934-75377956 TTTATTTTAGTATTTTCCTAGGG - Intronic
1194026521 X:88759678-88759700 TTTTATTTTGTATCTTACTATGG - Intergenic
1194207266 X:91026838-91026860 TTTCTTTTACTATTTTACTAAGG + Intergenic
1194244151 X:91490989-91491011 ATACACTCAGTATTTTACAATGG + Intergenic
1194277233 X:91900374-91900396 ATTCTTCTAGTAGGTTACTAGGG + Intronic
1194330352 X:92576812-92576834 CATCATTTAGTTTTTTACTTAGG + Intronic
1194354536 X:92865987-92866009 ATTCATTTATCATTTTATTTAGG + Intergenic
1194418499 X:93643150-93643172 TTTCATTTAGTATGTTTCCAAGG - Intergenic
1194720900 X:97339065-97339087 ATACTGTTAGTATATTACTAAGG + Intronic
1195522220 X:105844459-105844481 ATTCATTTTCCATTTTAGTAAGG - Intronic
1195547722 X:106131772-106131794 ATTCATTTTGTGTTTTATTCTGG - Intergenic
1195612365 X:106882389-106882411 ATTCTTTTAGTATTATAATACGG - Intronic
1195840722 X:109173254-109173276 AAACATTCATTATTTTACTAAGG - Intergenic
1196335708 X:114530815-114530837 AGTCATTTACTATTTTTCTTTGG + Intergenic
1196365776 X:114922052-114922074 ATTAATTTATTATTTTATTATGG + Intergenic
1196509581 X:116492058-116492080 AATTATTTATTATTTTGCTATGG + Intergenic
1196702630 X:118687992-118688014 GTTAATTTTGTATTTTAATAGGG + Intergenic
1196962508 X:121018559-121018581 CTTTATTTTGTATTTTACCATGG - Intergenic
1197053617 X:122091752-122091774 ATTCATTTACTATCTGACTTTGG + Intergenic
1197334888 X:125201816-125201838 ATGCATTAAATAATTTACTATGG - Intergenic
1197483586 X:127018681-127018703 ATTTTGTTATTATTTTACTAAGG + Intergenic
1197801840 X:130358232-130358254 ATTCATTTAATAGAATACTATGG - Intronic
1197831949 X:130652397-130652419 ATTCATTTAATAATTTTCTCAGG + Intronic
1197950365 X:131889352-131889374 CTTCAGTTAGTTTTTTAATAAGG - Intergenic
1197956311 X:131952318-131952340 ATTTAGCTAGTATTTTATTAAGG - Intergenic
1198595588 X:138231962-138231984 ATTCATCTAGTATTTTTTCAAGG - Intergenic
1198796709 X:140404457-140404479 ATTTATTTATTTTTTTATTATGG + Intergenic
1199238205 X:145515037-145515059 ATGCATTTTGTATTCTAATATGG - Intergenic
1200553008 Y:4601577-4601599 TTTCTTTTACTATTTTACTAAGG + Intergenic
1200563132 Y:4732307-4732329 ATACACTCAGTATTTTACAATGG + Intergenic
1200639057 Y:5695880-5695902 CATCATTTAGTTTTTTACTTAGG + Intronic
1200662896 Y:5983017-5983039 ATTCATTTATCATTTTATTTAGG + Intergenic
1201314327 Y:12628966-12628988 ATTCATTTAATATTTTTTCAAGG + Intergenic
1202036087 Y:20637656-20637678 TTTCATTTAGTATTTTGTTAAGG + Intergenic