ID: 1059234829

View in Genome Browser
Species Human (GRCh38)
Location 9:112752064-112752086
Sequence ATTCATTTAGTATTTTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059234829_1059234834 2 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT No data
Right 1059234834 9:112752089-112752111 CCCCTTGTCCCAATATTAATGGG No data
1059234829_1059234832 1 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT No data
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data
1059234829_1059234838 9 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT No data
Right 1059234838 9:112752096-112752118 TCCCAATATTAATGGGAGCAGGG No data
1059234829_1059234837 8 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT No data
Right 1059234837 9:112752095-112752117 GTCCCAATATTAATGGGAGCAGG No data
1059234829_1059234840 10 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT No data
Right 1059234840 9:112752097-112752119 CCCAATATTAATGGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059234829 Original CRISPR ATTCATTTAGTATTTTACTA GGG (reversed) Intronic