ID: 1059234830

View in Genome Browser
Species Human (GRCh38)
Location 9:112752065-112752087
Sequence AATTCATTTAGTATTTTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 589}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059234830_1059234840 9 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT 0: 1
1: 0
2: 4
3: 50
4: 589
Right 1059234840 9:112752097-112752119 CCCAATATTAATGGGAGCAGGGG No data
1059234830_1059234834 1 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT 0: 1
1: 0
2: 4
3: 50
4: 589
Right 1059234834 9:112752089-112752111 CCCCTTGTCCCAATATTAATGGG No data
1059234830_1059234837 7 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT 0: 1
1: 0
2: 4
3: 50
4: 589
Right 1059234837 9:112752095-112752117 GTCCCAATATTAATGGGAGCAGG No data
1059234830_1059234838 8 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT 0: 1
1: 0
2: 4
3: 50
4: 589
Right 1059234838 9:112752096-112752118 TCCCAATATTAATGGGAGCAGGG No data
1059234830_1059234832 0 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT 0: 1
1: 0
2: 4
3: 50
4: 589
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059234830 Original CRISPR AATTCATTTAGTATTTTACT AGG (reversed) Intronic
900875942 1:5342601-5342623 AAATCATTTTTTATGTTACTAGG + Intergenic
901249328 1:7762596-7762618 ACTTCATTTATGATTTCACTAGG + Intronic
901280311 1:8028134-8028156 CATTCATTTAGTATTATTTTAGG + Intergenic
901707655 1:11087959-11087981 AGTTCACTTTGTACTTTACTGGG - Intronic
902371159 1:16007743-16007765 TATTCAATGACTATTTTACTAGG + Exonic
903434910 1:23341678-23341700 AGCTCACTTAGTATTTTATTTGG - Intronic
904294497 1:29509369-29509391 CATTCATTGAGTTTTTTATTTGG - Intergenic
905139036 1:35826385-35826407 AATTCATTTATTATCCTTCTGGG + Intronic
906838978 1:49115671-49115693 ATTTCAATGAGGATTTTACTTGG - Intronic
906899846 1:49822835-49822857 AATTCATTTCTTATTCTACCTGG + Intronic
907014779 1:51001724-51001746 AATTAATTTAGTTTTTAAATGGG - Intergenic
907647376 1:56257933-56257955 AATTCTTTTAGAATTATCCTGGG - Intergenic
907803423 1:57794254-57794276 AATTTGTTTACTATTTTCCTAGG - Intronic
908614415 1:65902753-65902775 AATTCATATAGTCATGTACTTGG - Intronic
908959706 1:69681623-69681645 ATTTTATTTTGTATTTTAATGGG - Intronic
910066273 1:83155202-83155224 TATTCATTTAGAGTTTTACATGG - Intergenic
910120744 1:83787006-83787028 AATTCATTTATGTTGTTACTTGG - Intergenic
910189617 1:84582170-84582192 AATTTATTTTGTTTTTTACTGGG - Intergenic
910809560 1:91222254-91222276 AATTAATTTTTTGTTTTACTTGG - Intergenic
911334628 1:96567124-96567146 TGTTCATTGTGTATTTTACTTGG - Intergenic
911374547 1:97035916-97035938 AATTCATTTAACATTTTACTAGG - Intergenic
911506084 1:98753547-98753569 ATTTCATTTTGAATTTTACCTGG + Intronic
911547733 1:99240032-99240054 TATACATTTATTATTTTATTTGG - Intergenic
912066902 1:105755932-105755954 TTTTGATTTAGTATTTTTCTAGG - Intergenic
912160268 1:106974442-106974464 AAATTATTTAGCATTATACTTGG - Intergenic
912241503 1:107914958-107914980 AACTCATTTTTTATTTTAATTGG + Intronic
913387497 1:118275468-118275490 AATTCTTCTAGTACTTTACCTGG + Intergenic
915721027 1:157985783-157985805 GCTTCATTTTGTTTTTTACTTGG + Intergenic
916211798 1:162365711-162365733 AATTCATTAAGTATACTAATGGG - Intronic
916686282 1:167150334-167150356 ATTTAATTTTGTAGTTTACTGGG - Intergenic
916928607 1:169550361-169550383 AATTCTTTAAATATTCTACTTGG + Intronic
916932927 1:169598102-169598124 AATTCATTTATTCATTCACTTGG - Intronic
918454438 1:184693711-184693733 AATTCATTTAGTAGTGGAGTGGG - Exonic
918574472 1:186040361-186040383 AATGCATTTAAAATTTTTCTAGG - Intronic
918835804 1:189463987-189464009 ACTTAATTTAATATTTTAATAGG - Intergenic
918903022 1:190450448-190450470 AATTTATACAGTATTTTAATAGG + Intronic
918918351 1:190672845-190672867 TTTTCATTTACTATTTTTCTAGG + Intergenic
919001829 1:191842511-191842533 TATTTATTTTATATTTTACTGGG + Intergenic
919084252 1:192902411-192902433 AGTTCATTTACTATGTGACTTGG - Intergenic
919721344 1:200839841-200839863 AATTTATTTCTTATTTTAATAGG - Intronic
919948335 1:202339692-202339714 AATTTACTTAGCATTTTATTAGG + Intronic
920551888 1:206868840-206868862 AATGTATTTATTTTTTTACTTGG + Exonic
921073258 1:211679455-211679477 TACTCATTTAGAATTATACTAGG + Intergenic
921566516 1:216728099-216728121 AATGCATTTGGTATCTTACCAGG - Intronic
922409920 1:225362655-225362677 ATTTCATTTTGTTTTTTAATAGG - Intronic
922708220 1:227803526-227803548 AATTCATTGAGTTTTTTTTTTGG + Intergenic
923403008 1:233633609-233633631 AATAAATTTAGTATTTTACAGGG - Intronic
923999489 1:239534761-239534783 GGAACATTTAGTATTTTACTTGG + Intronic
1063064820 10:2597247-2597269 AATTCTTTTAGGATTTTTATTGG - Intergenic
1063758920 10:9049259-9049281 GTTTACTTTAGTATTTTACTTGG - Intergenic
1064494593 10:15895756-15895778 AATTCATTTAGTCTATTAACAGG - Intergenic
1065951610 10:30657538-30657560 AATTCTTTTTGTATTTAATTCGG + Intergenic
1067822758 10:49544545-49544567 AATAAATTTAGTTTTATACTTGG + Intergenic
1069104181 10:64362909-64362931 ATTTCATTTATTCTTTTTCTAGG - Intergenic
1069146847 10:64903292-64903314 AATTTATTTTGTATTTTTCGGGG - Intergenic
1069202186 10:65634110-65634132 ACTTCCTTTAGCATTTTAGTAGG - Intergenic
1069397818 10:68009054-68009076 AATTTTTTTAGTATTTTTATTGG - Intronic
1069731266 10:70616213-70616235 TATTTATTTAGTTTTTTACGTGG + Intergenic
1072276534 10:93828743-93828765 CAGGCATTTTGTATTTTACTTGG - Intergenic
1074669893 10:115778383-115778405 AATTCACTTAGCATTTTATCTGG - Intronic
1077954157 11:6995487-6995509 ACTTTATTTAGTATTTTAATAGG - Intergenic
1078361413 11:10671083-10671105 AATTGCTTTAGTATTTTTCCAGG + Intronic
1079511327 11:21214618-21214640 AAATCATTTGGTAGTTTTCTTGG + Intronic
1079557578 11:21779180-21779202 ACTATATTTAGTATTTTCCTGGG - Intergenic
1079843909 11:25439238-25439260 AAATTATTTAATATTTTTCTCGG - Intergenic
1080102253 11:28473202-28473224 ATTCCATTTAATATTTTAATAGG + Intergenic
1080159953 11:29161613-29161635 AATTCATTTTCTATTTTAAATGG + Intergenic
1080882076 11:36331350-36331372 AATTCATTTAGAATTGCATTTGG + Intronic
1080938858 11:36891725-36891747 AATTCCTTTAGTATTACAATTGG - Intergenic
1081053526 11:38377504-38377526 AATTCATTTATCATATGACTCGG + Intergenic
1081072654 11:38630084-38630106 TATTGATTTACTATTTTTCTAGG - Intergenic
1081233813 11:40620487-40620509 GATTCAATTGGTATTATACTGGG + Intronic
1082592296 11:55027221-55027243 ATTTCTTCTAGTATTTTTCTGGG + Intergenic
1082903041 11:58276927-58276949 AATAAAGTTAGTACTTTACTAGG + Intergenic
1083573608 11:63773301-63773323 AATTCCTTTGGGATTTTACAAGG - Intergenic
1084129492 11:67122192-67122214 AATTCCTTTAGTAATCTTCTAGG - Intronic
1085654993 11:78305900-78305922 ATTTTATTTAGAATTTCACTAGG - Intronic
1086193174 11:84104798-84104820 AATGCTTTTAGTATTTTACTAGG - Intronic
1086198433 11:84170290-84170312 AATTTATTCAGTATTTAAGTTGG - Intronic
1086372013 11:86164433-86164455 AATATATTTAGCATTTTTCTTGG + Intergenic
1087604337 11:100358271-100358293 TATTTGTTTAATATTTTACTGGG - Exonic
1087956405 11:104293196-104293218 AAGTCACTTAATATTTTACTTGG - Intergenic
1088103501 11:106180241-106180263 AATTCCTTTTTTGTTTTACTTGG - Intergenic
1088147593 11:106701158-106701180 AATGCATATAATAATTTACTGGG - Intronic
1088450385 11:109975470-109975492 AATTCATTTACTATTTCACTTGG + Intergenic
1091115674 11:133010706-133010728 AATTTATTTACTATTTCACTTGG - Intronic
1091188451 11:133668498-133668520 AATTCAGCTAGTACTTTAATTGG + Intergenic
1091634165 12:2184921-2184943 TAGTCATTTAGTATTGAACTGGG + Intronic
1091643675 12:2256873-2256895 AATCCATTTACTATTTTAAAAGG - Intronic
1092991166 12:13901005-13901027 ACTTCAGTTATTATTGTACTAGG - Intronic
1093430483 12:19079879-19079901 AATTTATTTTTTATTTTAATAGG - Intergenic
1093546667 12:20356803-20356825 AATTCACTAAGTTATTTACTTGG - Intergenic
1093637317 12:21486836-21486858 AATTTCTTTTGTATTTTAGTAGG + Intronic
1093837203 12:23847967-23847989 AATTCATTCAGTAAATTAATAGG + Intronic
1093869279 12:24267742-24267764 AGTTCATGTATTATTTTATTTGG + Intergenic
1093964416 12:25309922-25309944 TTTTCATTTAGTATTTTTCTAGG - Intergenic
1094548347 12:31426686-31426708 ATTTCATTTAGTCTTTTTATTGG + Intronic
1094632356 12:32188251-32188273 ATTTTATTTACTATTTAACTGGG + Intronic
1095649149 12:44586687-44586709 AATACATCTATTATTGTACTTGG - Intronic
1097006376 12:55921700-55921722 AACTCTTTTAGTTTTTTACTTGG - Intronic
1098028653 12:66232149-66232171 AATGTATTTTATATTTTACTTGG + Intronic
1098363994 12:69683255-69683277 AATTTATTGAGTATTTTGCTGGG + Intronic
1098520360 12:71428967-71428989 TATTCATTTAGTATTTTGTTTGG - Intronic
1098536723 12:71601606-71601628 AATTCTTTTTGGATTTTCCTTGG - Intergenic
1099610852 12:84867443-84867465 GACTCATTTATTATTGTACTTGG - Intronic
1100458182 12:94773096-94773118 AATTCATTTATTCATTTATTTGG + Intergenic
1102325084 12:111974043-111974065 TATTTTTTTAGTATTTTAATAGG - Intronic
1105261107 13:18779945-18779967 AACTCATGTGGAATTTTACTGGG - Intergenic
1105718728 13:23093039-23093061 AATTCATGCAGTAATTAACTGGG - Intergenic
1106328427 13:28716878-28716900 AATTCATTTCATCTTTCACTGGG + Intronic
1107486743 13:40834893-40834915 AATTTATTTAGTTAGTTACTTGG - Intergenic
1107589164 13:41883424-41883446 TATCCATATAGTATTTTACTAGG - Exonic
1108434937 13:50392597-50392619 TATGCATTTAGCATTTTGCTGGG + Intronic
1108644386 13:52411910-52411932 AATTCAGTTAATACTTTACTAGG + Intergenic
1108942551 13:55975692-55975714 AATTTATTTTTTATTTTAGTAGG + Intergenic
1109053993 13:57523148-57523170 CTTTCATTAAGTATTTTGCTGGG - Intergenic
1109156125 13:58912189-58912211 AGTTCATTTGGTATTTCTCTGGG + Intergenic
1109376966 13:61508673-61508695 AATTCATTTAGTTTTTAGCCTGG + Intergenic
1110772312 13:79363875-79363897 ACTTCAATTAACATTTTACTGGG - Intronic
1110776673 13:79415814-79415836 ACTTTATTTAGTATATTAATAGG - Intergenic
1111073492 13:83200875-83200897 AATGCCTTTGGTATTTTATTTGG - Intergenic
1111436685 13:88220032-88220054 AATTAATTTCGTATTTTTGTAGG + Intergenic
1111486397 13:88906199-88906221 AATCCATTTAATAATTTCCTCGG + Intergenic
1111519005 13:89375007-89375029 ATTTCACTTAATATTTTATTAGG - Intergenic
1111641780 13:90978715-90978737 TTTTCATGGAGTATTTTACTGGG - Intergenic
1112412794 13:99178517-99178539 AAATCATTTCGTATTCTCCTAGG - Intergenic
1113155494 13:107315836-107315858 AATTCATTTATCATTTTTATTGG - Intronic
1113700219 13:112379790-112379812 TCTTCATTTAGAATTTTACTTGG + Intronic
1114062696 14:19034514-19034536 AATTCTTTTAGTATATTAACTGG + Intergenic
1114099564 14:19365483-19365505 AATTCTTTTAGTATATTAACTGG - Intergenic
1114732528 14:25008595-25008617 AATTCATGTTTTATTTAACTTGG + Intronic
1114850192 14:26374135-26374157 AATCCATTTAGGACTTTCCTAGG + Intergenic
1115393495 14:32879898-32879920 TATTCATTTAATGTGTTACTAGG - Intergenic
1116560112 14:46367867-46367889 AATTCATTTACTTATTTACTTGG + Intergenic
1117278596 14:54215063-54215085 AATTCTTTAAACATTTTACTTGG - Intergenic
1117731014 14:58721750-58721772 TATTCTTTTAGGCTTTTACTTGG + Intergenic
1117964619 14:61194081-61194103 AATTAATTTAGTTTTTTAAAAGG + Intronic
1119710142 14:76816007-76816029 AATCCAGTGTGTATTTTACTTGG + Intronic
1120653060 14:87157887-87157909 AATTGATTTAGAATTTCATTTGG + Intergenic
1120909407 14:89652286-89652308 ATTTTCTTTAGTAATTTACTCGG + Intergenic
1121188502 14:92000191-92000213 AATTCATTTAATTTTTAAATAGG + Intronic
1202846782 14_GL000009v2_random:184856-184878 CATTCACTTATTATTTTACAAGG + Intergenic
1202916244 14_GL000194v1_random:175457-175479 CATTCACTTATTATTTTACAAGG + Intergenic
1202876532 14_KI270722v1_random:7588-7610 CATTCACTTATTATTTTACAAGG - Intergenic
1123494093 15:20806961-20806983 AATTCTTTTAGTATATTAACTGG - Intergenic
1123550591 15:21376043-21376065 AATTCTTTTAGTATATTAACTGG - Intergenic
1123788989 15:23700891-23700913 AATTCTTTAAGTATTTTAAAAGG + Intergenic
1123899660 15:24863646-24863668 AATTCATTTAGTTATTAAGTTGG - Intronic
1124148160 15:27150600-27150622 AAATCATTTTGTATTTTCATTGG - Intronic
1124160525 15:27264395-27264417 AGTTCATATAGTATTTTATAAGG - Intronic
1125241246 15:37579357-37579379 AATTCATTTACAATTTTTATGGG + Intergenic
1126062542 15:44796900-44796922 TATTCATTTAGCATTTAATTTGG - Intergenic
1126746187 15:51828907-51828929 TATTCATTTAGTCACTTACTGGG - Intergenic
1127404610 15:58629345-58629367 TAGTCAATTATTATTTTACTAGG + Intronic
1127635739 15:60867862-60867884 AATTTATTTCGTATTTCACCTGG - Intronic
1127743091 15:61933238-61933260 AATTCATTCTTCATTTTACTTGG - Intronic
1127853298 15:62934233-62934255 TAGTCATTTTGTATTTTTCTAGG + Intergenic
1130130409 15:81136402-81136424 ATTTCATTCAGGATTTCACTTGG - Intronic
1130174021 15:81548656-81548678 AAAGCATTTGGAATTTTACTAGG + Intergenic
1131852339 15:96556476-96556498 AATTCATGTATTATTTTAAAGGG - Intergenic
1131907472 15:97158929-97158951 AATTCATTTACTATTTTGCATGG + Intergenic
1132062837 15:98706677-98706699 CCTTCACTTAATATTTTACTAGG - Intronic
1132290402 15:100697051-100697073 TATTCATTTTGTATTTTTTTTGG - Intergenic
1202958934 15_KI270727v1_random:103297-103319 AATTCTTTTAGTATATTAACTGG - Intergenic
1133080159 16:3312251-3312273 AATTCCTTCTGTATTTTACAAGG - Intronic
1133841721 16:9416106-9416128 AATTCATTTTGTTTTTCTCTGGG + Intergenic
1135501223 16:22997617-22997639 AATTCATGTATTATTCTAATGGG - Intergenic
1136501915 16:30675207-30675229 AATTCATTTTTAATTTTTCTGGG + Intergenic
1137386044 16:48043466-48043488 AAATCATTTAGAATTGTAGTGGG - Intergenic
1140078296 16:71722608-71722630 AAATCCTTTAGTAGTTTATTGGG - Intronic
1140597547 16:76434665-76434687 TTTTCATTTACTATTTTTCTTGG + Intronic
1203119101 16_KI270728v1_random:1520744-1520766 AATTAATTAAGTATATTTCTGGG - Intergenic
1143995690 17:11004622-11004644 AATTCAGTAAGTTTATTACTGGG - Intergenic
1144137118 17:12306715-12306737 ATTCCATTTAGTTTTTTATTTGG + Intergenic
1146294017 17:31634161-31634183 AATTCTTTGAGTAATTTACAAGG - Intergenic
1146659346 17:34653901-34653923 AATTCATTTAAAATGTTCCTTGG - Intergenic
1147031391 17:37640495-37640517 AATTTCTTTTGTATTTTTCTGGG - Intronic
1148012604 17:44495715-44495737 AATTGGTTTAATATTGTACTAGG - Intronic
1149426971 17:56564575-56564597 ATTTGATTTACTATTTTCCTAGG - Intergenic
1149542978 17:57482336-57482358 ACTTCATTTATTATTTTGATGGG + Intronic
1149797214 17:59531698-59531720 AATTCCTTAAGTATTTTATCAGG - Intergenic
1150567926 17:66359164-66359186 AATTCACTTTTTAATTTACTTGG - Intronic
1153709058 18:7779255-7779277 AATTCTCTTAGTATTTTTCCAGG + Intronic
1154451621 18:14481419-14481441 AATTCTTTTAGTATATTAACTGG - Intergenic
1155189936 18:23420860-23420882 AATTCAAATAGTATTTTCCTGGG - Intronic
1155439312 18:25844781-25844803 AATTCATTCAGTATCCTACAGGG + Intergenic
1155577321 18:27262196-27262218 AATTCATTCAGTTTTTATCTGGG + Intergenic
1155592365 18:27441680-27441702 TATTCATTTATTAGTATACTAGG - Intergenic
1155789221 18:29944436-29944458 AATTCACTCAGTTTTTAACTGGG + Intergenic
1155875880 18:31087876-31087898 AATTCATTTTGGCTTTAACTTGG + Intronic
1155901364 18:31394958-31394980 AATTCTTCTATTATTTTAGTAGG - Intronic
1156233182 18:35174747-35174769 AATTTATTTATTTTTTTAATTGG + Intergenic
1157021659 18:43790247-43790269 AATTGATTCAGTGTTTCACTCGG + Intergenic
1157036256 18:43978602-43978624 TATTTATTAAATATTTTACTAGG + Intergenic
1158060185 18:53331304-53331326 AATTCATTTAGCATACCACTTGG + Intronic
1158092110 18:53726976-53726998 AACTCATTTTTTATTTTACAGGG - Intergenic
1159145584 18:64450060-64450082 ATTTCTTTTTGTATTTTAATTGG - Intergenic
1159170262 18:64757066-64757088 AATCAATTAAGTATTTTAATAGG - Intergenic
1159296599 18:66497932-66497954 AATTAATTTAAGATTTTATTTGG + Intergenic
1159623429 18:70666708-70666730 AATTCAGTTGGAATTTTGCTAGG + Intergenic
1160740932 19:685544-685566 AAGTCAGTTAACATTTTACTGGG + Exonic
1161629730 19:5347090-5347112 AATTCATTTACTAGTTTTATAGG - Intergenic
1164256876 19:23534864-23534886 AATTCTTTAAGTATTTTAAAAGG - Intronic
1166659141 19:44634408-44634430 AATTCTTTGAGTAATTTACAAGG + Intronic
1167863684 19:52306678-52306700 AATTCTTTAAGTATTTTAAAAGG + Intronic
1202637692 1_KI270706v1_random:56192-56214 AACTCATGTAGAATTTTAATGGG - Intergenic
1202674130 1_KI270710v1_random:25228-25250 CATTCACTTATTATTTTACAAGG + Intergenic
925244487 2:2368673-2368695 ACTTCCTTTAGTATTTTAAGCGG - Intergenic
925898774 2:8494038-8494060 AATTCTTTTTTTATTTTTCTGGG - Intergenic
926568133 2:14500537-14500559 AATTCATTTTGTTTTTTTCATGG - Intergenic
926877205 2:17494656-17494678 AACTTATTTATTAATTTACTAGG + Intergenic
926968731 2:18444762-18444784 AATTCAGTGAGTAATTTTCTAGG + Intergenic
927395594 2:22646988-22647010 CATTCATTAAGTATTGTATTAGG - Intergenic
927626526 2:24726713-24726735 AATACATTTTGTATTTTATAAGG + Intronic
928259950 2:29757483-29757505 TAGACATTTTGTATTTTACTTGG - Intronic
929303629 2:40334321-40334343 AAATCGTTGAGTATTTGACTGGG - Intronic
930344016 2:50155338-50155360 CATTCATTTATTATTTTGCTTGG + Intronic
932426684 2:71642035-71642057 AATTCCTTTGGAAATTTACTTGG + Intronic
932583889 2:73010197-73010219 ATTTCATTTAGAATTTAGCTGGG - Intronic
933099566 2:78236103-78236125 AATTCATTAATTATTTTAAGAGG + Intergenic
933498981 2:83088359-83088381 AATAAAGTTAGTCTTTTACTAGG + Intergenic
933522576 2:83391953-83391975 TATTCTCTTAGTATTTTCCTGGG - Intergenic
934068585 2:88363067-88363089 AATTTATTTTGTATTTCAATAGG - Intergenic
934817844 2:97345568-97345590 AATTTATTTAATATTTTTGTAGG + Intergenic
934819852 2:97362916-97362938 AATTTATTTAATATTTTTGTAGG - Intergenic
934873301 2:97888000-97888022 AATACATTTAATAGTTTAATGGG + Intronic
935017218 2:99195228-99195250 AATGCATTTAGAATTACACTAGG - Exonic
935426455 2:102923788-102923810 AATTCATTAATTGTGTTACTTGG - Intergenic
935521972 2:104118582-104118604 AATGCACTTAGTAATTTAATAGG - Intergenic
936756341 2:115717278-115717300 AATTCATTAAAAATATTACTGGG + Intronic
938004143 2:127773930-127773952 AATTTTTTTTGTATTTTAGTAGG + Intronic
938845547 2:135205202-135205224 AATTCATCCAATATTTTAGTGGG + Intronic
939223951 2:139340980-139341002 AATTGATTAAGTTTTTTTCTGGG + Intergenic
939426568 2:142046086-142046108 AAGTCATTTAGTACTTTTTTTGG - Intronic
939449001 2:142348314-142348336 AGTTCATTATGTATTTTGCTTGG + Intergenic
939648356 2:144730184-144730206 AATGCATTTAGTATTTGTTTTGG + Intergenic
939726752 2:145730099-145730121 TCTTCATCTAGTATTTTTCTTGG - Intergenic
940556354 2:155233533-155233555 AAAATATTTAGTATTTTAATGGG - Intergenic
941176950 2:162209229-162209251 AATTCAATTAGTATTTGAAGAGG - Intronic
941192474 2:162402583-162402605 AATTCATTTGTTTTGTTACTTGG - Intronic
941696344 2:168556291-168556313 AATTCTTTTAATGTGTTACTAGG - Intronic
942590283 2:177537063-177537085 AATTCAATTAGTATGATAATAGG + Intronic
942755782 2:179339432-179339454 AATACATTTCTTATTTTATTGGG + Intergenic
942813777 2:180027231-180027253 AATTGATCTACTATTTTAATAGG + Intergenic
943030287 2:182677940-182677962 ATTTTATTGAGTATTTTATTAGG - Intergenic
943445013 2:187973890-187973912 AATTTCCTTAGTATTTTACCTGG - Intergenic
943455188 2:188098201-188098223 TAGTCACTTAATATTTTACTTGG - Intergenic
943513038 2:188850356-188850378 AATTCATTTTCTATTGAACTTGG + Intergenic
943722410 2:191218982-191219004 AATGCAATTAAAATTTTACTTGG + Intergenic
944042430 2:195370919-195370941 AATTCTTTCAGAATTTTTCTAGG + Intergenic
944370376 2:198975079-198975101 AATTTATTTTTTATTTGACTGGG - Intergenic
945521396 2:210832336-210832358 AATTTATTTTTTATTTTACTGGG + Intergenic
945566867 2:211411892-211411914 AATTAATATTGTATTTCACTTGG + Intronic
945622889 2:212164358-212164380 AATTAGTTTAGTAATATACTTGG - Intronic
945991079 2:216395795-216395817 AATTCATTTATTCATTCACTTGG + Intergenic
946270736 2:218591194-218591216 AATTATTTTACTATTTTATTGGG - Intronic
946735573 2:222751182-222751204 AATTAACTTAGTATTTGGCTGGG - Intergenic
946754497 2:222930599-222930621 AACTCAATTATTATTTTATTAGG + Exonic
946775699 2:223138279-223138301 AATGAATTCAGTGTTTTACTTGG + Intronic
946968178 2:225061967-225061989 GTTTCATTCAGTATTTTTCTTGG + Intergenic
947866491 2:233401339-233401361 AATTCATTTATTATATCATTTGG + Intronic
1169015664 20:2290759-2290781 AATGCATTTTGTCTTTTACAAGG + Intergenic
1169067560 20:2702665-2702687 AATCAATTTATTCTTTTACTTGG - Intronic
1169416950 20:5425534-5425556 GATTAATCTGGTATTTTACTTGG - Intergenic
1169807503 20:9574582-9574604 AATTCATTTTGTTTTTAATTTGG + Intronic
1170208635 20:13825926-13825948 AATTCATTTAATGCTTTATTAGG + Intergenic
1170264718 20:14452457-14452479 AATTAATTTAGTAATTTATTTGG - Intronic
1170719253 20:18860781-18860803 AATTCATTCACTATTATAGTTGG - Intergenic
1170777363 20:19388824-19388846 AATCCATTCAGTCTTTTAATTGG + Intronic
1170964509 20:21054074-21054096 CATTCATTTAGGATTTTAAATGG - Intergenic
1173672433 20:44808217-44808239 AAATTCTTTAGTATTTCACTTGG - Intronic
1174704092 20:52638219-52638241 AATTTATTTAGTCTTTTAAATGG - Intergenic
1175145396 20:56892344-56892366 AATTCCTTTATTATTTGAGTGGG + Intergenic
1176444523 21:6808804-6808826 AATTCTTTTAGTATATTAACTGG + Intergenic
1176635596 21:9190103-9190125 CATTCACTTATTATTTTACAAGG + Intergenic
1176637799 21:9265031-9265053 CATTCACTTATTATTTTACAAGG - Intergenic
1176822689 21:13673842-13673864 AATTCTTTTAGTATATTAACTGG + Intergenic
1176919904 21:14675826-14675848 GCTTCATTTTCTATTTTACTTGG + Intergenic
1177116945 21:17097199-17097221 ATATCAGTTAGTTTTTTACTTGG - Intergenic
1177511855 21:22097546-22097568 ATTTTATTCAGTATTTTTCTTGG + Intergenic
1177526558 21:22299712-22299734 AATTTATTTTCTATTTTAATAGG - Intergenic
1177646131 21:23901749-23901771 CATGCATTTATTATTTTACTGGG - Intergenic
1178579578 21:33827004-33827026 AATCCATTAATAATTTTACTTGG + Intronic
1178768230 21:35475635-35475657 AATTCATCTAGATTTTTACAGGG - Intronic
1180371166 22:12038374-12038396 CATTCACTTATTATTTTACAAGG + Intergenic
1180414522 22:12696357-12696379 CATTCACTTATTATTTTACAAGG - Intergenic
1180421839 22:12872528-12872550 CATTCACTTATTATTTTACAAGG - Intergenic
1180481189 22:15757141-15757163 AATTCTTTTAGTATATTAACTGG + Intergenic
1180688787 22:17692813-17692835 ATTTCATTTTATTTTTTACTTGG - Intronic
1182997461 22:34827339-34827361 AATGCATTTAGTATTTAATAAGG - Intergenic
949170167 3:987631-987653 TTTTCATTTACTATTTTTCTAGG + Intergenic
950868479 3:16208764-16208786 CATACATTAAGTAATTTACTAGG - Intronic
951226721 3:20129036-20129058 TATTCATTTAGGATTTTCATGGG + Intronic
951300606 3:20991270-20991292 ACTTCACTTGGTATTTTACAGGG + Intergenic
951578361 3:24136592-24136614 ATTTCATATAGTAGTTTACGAGG - Intronic
951671505 3:25188633-25188655 AAGTCATTCTGTATTTTATTAGG + Intronic
951847976 3:27105003-27105025 AATTATTTTAGCATTTTACAGGG + Intergenic
951853393 3:27168417-27168439 AATTTGTTTAGGATTTTCCTGGG - Intronic
951929237 3:27945190-27945212 AATTCATCTGGTATTTAACCAGG - Intergenic
952072067 3:29649181-29649203 AATTTATTTAGTTTTTGAATAGG + Intronic
952279665 3:31910857-31910879 AATTCATGAAGTAGTTTATTAGG - Intronic
952525468 3:34205950-34205972 TATTCATTTAGCATTTAATTTGG + Intergenic
952649133 3:35702356-35702378 CATTCATTTATTATTTTCTTTGG + Intronic
952938602 3:38422049-38422071 AATTCTTTAAGTATTTTAAAAGG - Intergenic
954251304 3:49369565-49369587 AATTTCTTTCGTATTTTAGTAGG - Intronic
955061489 3:55495910-55495932 TAGTCATTTAGTAAGTTACTTGG + Intergenic
955110892 3:55948934-55948956 AAATAATTTAGAATTGTACTTGG - Intronic
955189847 3:56750902-56750924 AATTTAATTAAAATTTTACTAGG + Intronic
955695944 3:61636839-61636861 ATCTCATGTAGTATTTTACTTGG + Intronic
955756969 3:62234887-62234909 AATTCATTTGGAATTTAACCTGG + Intronic
955802678 3:62702202-62702224 AATTTATTTAGAAGTTTATTTGG - Intronic
955817333 3:62859399-62859421 TATTCAATTAGTATTTGAGTCGG - Intronic
956685470 3:71823481-71823503 AATATATTTAATATTTTACCTGG + Intergenic
956766695 3:72490296-72490318 AATACATTCAGTTTTGTACTTGG - Intergenic
957103074 3:75852011-75852033 CATTCATTTATTATTTTACAAGG + Intergenic
957439120 3:80219361-80219383 AATTCCTTTATTATTTCAATGGG + Intergenic
957709748 3:83840522-83840544 AAAACATTTAGTAACTTACTGGG - Intergenic
958147759 3:89648757-89648779 AATGCATTTAGCATTGTGCTTGG - Intergenic
958176973 3:90008343-90008365 AATGCATTGAGTTTGTTACTTGG - Intergenic
958187741 3:90144987-90145009 AATTTATTTACTATTGTTCTAGG - Intergenic
958468618 3:94489797-94489819 GCTTCATTTAGTATTTTAAATGG - Intergenic
958702987 3:97616933-97616955 TTCTCATTGAGTATTTTACTGGG - Intronic
958830641 3:99084562-99084584 AATATATTTACTATTTTCCTTGG - Intergenic
958940167 3:100303264-100303286 TATTTATGTTGTATTTTACTGGG + Intronic
958987760 3:100802425-100802447 AATTCAGATAATATTTAACTTGG - Intronic
959827568 3:110817296-110817318 AATTCCTTTAGTATTTCATTTGG - Intergenic
960468184 3:118025148-118025170 AATTAAGTTAGTATTTTGATAGG + Intergenic
962152600 3:132908698-132908720 ATTTCATTTAGAATTATATTGGG + Intergenic
962303607 3:134266302-134266324 AATTCATGGATTATTTTATTTGG + Intergenic
963217711 3:142769086-142769108 AATTCTGTTAGTATTTATCTGGG + Intronic
963257296 3:143158597-143158619 AATTCAGTTAGGATTTTTTTTGG + Intergenic
963557922 3:146818743-146818765 CACTCATTTAGAATTTTATTTGG + Intergenic
963609358 3:147445678-147445700 AATACATTTAATAATTTAGTGGG - Intronic
963800281 3:149669286-149669308 AACTCATTTGGGATTTTCCTTGG - Intronic
964026200 3:152077956-152077978 ATTTTATTTAGCATTTTATTAGG + Intergenic
964121747 3:153192371-153192393 AAGTGATGTAGTATTTTAATGGG + Intergenic
964579650 3:158218680-158218702 AACTCTTTAGGTATTTTACTTGG + Intronic
964593671 3:158396855-158396877 ATTACATTAAGTATTTTACTGGG + Intronic
964873027 3:161334239-161334261 AATACATTTATTATTCTAATTGG + Intergenic
964907533 3:161736121-161736143 AATACATCTAGTCTATTACTGGG + Intergenic
965022129 3:163244304-163244326 CATTCATTTCTTAATTTACTGGG - Intergenic
965102931 3:164325925-164325947 AATTCATTTAATATTTTAGTTGG - Intergenic
965207676 3:165743070-165743092 TTTTGATTTACTATTTTACTAGG - Intergenic
965306680 3:167073188-167073210 AATTCATTGAAGATTTTGCTTGG - Intergenic
965343018 3:167513104-167513126 TTTTCATGTAGTATCTTACTGGG - Intronic
965426919 3:168536857-168536879 AATTCACTTTGAATTTTAGTAGG + Intergenic
965501423 3:169460625-169460647 AACACATTTATTATTTTACATGG + Intronic
966295376 3:178414766-178414788 AACTCATTTAGTTATTTATTGGG - Intergenic
966695410 3:182785318-182785340 CATTCATGTTGTATTTCACTAGG + Intergenic
967383405 3:188885361-188885383 AAGTCATTTGCTATTTAACTTGG - Exonic
967488526 3:190061830-190061852 AAGTCATTTAGTAATCCACTAGG - Intronic
967587176 3:191229620-191229642 AATTTATTTACTCTTTTACTAGG - Intronic
967650369 3:191978118-191978140 AATTCATTTTTTATTTCAATAGG - Intergenic
967804606 3:193704339-193704361 AATACATTTATTATTTGGCTTGG + Intergenic
1202749096 3_GL000221v1_random:139990-140012 CATTCACTTATTATTTTACAAGG + Intergenic
969148787 4:5149877-5149899 ATTTCCTTTAGTATTTTATGTGG + Intronic
969269983 4:6092980-6093002 TTTTCATTTTGTATTTTACTGGG + Intronic
969864907 4:10068928-10068950 TATTCATTTAGGGCTTTACTTGG + Intergenic
969895651 4:10302165-10302187 AATTCTTTAAGTATTTTAAAAGG + Intergenic
970055474 4:11966291-11966313 AATTCATTTATTATCTCCCTTGG + Intergenic
970119289 4:12734560-12734582 AAGTCATATAGTATTTTAAACGG + Intergenic
970622695 4:17841037-17841059 AATCCCTGTAGTATTTTTCTGGG + Intronic
971547114 4:27900044-27900066 AATTTATTTAGTATTTTTAGTGG - Intergenic
971643088 4:29160594-29160616 AATTTATTTAGCATAGTACTTGG + Intergenic
971719521 4:30227684-30227706 TCTTAATTTAGTATTTTATTTGG - Intergenic
971804111 4:31332486-31332508 AATTAATTTACTCTTTCACTTGG - Intergenic
971956701 4:33429805-33429827 ATTTAATTTTGTCTTTTACTTGG - Intergenic
972618212 4:40720953-40720975 TAGTCATTTAGTATTTTCCTAGG + Intergenic
972957262 4:44408195-44408217 ATTTCATTTAGTCTTTCATTGGG - Intronic
973253316 4:48083520-48083542 AATTAATTTAAGAGTTTACTTGG - Intronic
973297254 4:48538348-48538370 AATTTATTTAGAAATTTAATTGG + Intronic
973305875 4:48648934-48648956 AATTCATTAAGTATTCAATTTGG - Intronic
973316264 4:48763862-48763884 AATTCATTTGTTAGTTTAATTGG - Intronic
973393120 4:49572871-49572893 AACTCATGTAGAATTTTAATGGG + Intergenic
974586171 4:63880565-63880587 AAGTCCTATATTATTTTACTTGG + Intergenic
974610673 4:64211246-64211268 AATTCATTAAATATATTGCTGGG + Intergenic
974668981 4:65003625-65003647 TATTCTTTTAGATTTTTACTGGG - Intergenic
974698962 4:65413462-65413484 AATTCAGTTATGAATTTACTTGG - Intronic
974924524 4:68280879-68280901 AAATCACGAAGTATTTTACTTGG - Intergenic
975213441 4:71727595-71727617 AATTCATTTGGAATTTTAATGGG + Intergenic
975218698 4:71788254-71788276 AATTCATTTTTAATTTTACTTGG + Intronic
975406533 4:73996882-73996904 TATTTATTAAGTATTTTATTAGG - Exonic
975446913 4:74476082-74476104 AATTTATTAATTTTTTTACTTGG - Intergenic
975964347 4:79951847-79951869 AATTCATTTAGAAATTAATTAGG + Intronic
976560617 4:86496413-86496435 CATTTATTTTGTGTTTTACTAGG + Intronic
976712781 4:88090603-88090625 AATTCATTTAGTTTGTCAGTGGG - Exonic
976772433 4:88668066-88668088 AATTCACCTAGTACTTTGCTGGG - Exonic
976895287 4:90102400-90102422 ACTTCATTTATTATTTTAAGTGG + Intergenic
977103687 4:92852227-92852249 AAATCATGTTCTATTTTACTAGG + Intronic
977524160 4:98124665-98124687 ATCTCATGTAGTATCTTACTGGG + Intronic
977711500 4:100131685-100131707 AATGCACTTAGTATTGTATTTGG + Intergenic
977741836 4:100493680-100493702 AATGCAATTATTATTTTACACGG + Intronic
978028099 4:103902797-103902819 CATTCCTTTATTACTTTACTTGG - Intergenic
978253455 4:106661984-106662006 AATGCTTTTAGTATTTGGCTTGG - Intergenic
978509204 4:109497266-109497288 TTTTCATTTCGTATTTTATTTGG + Intronic
979122005 4:116914934-116914956 AATTTATTTTGGATTTTATTTGG + Intergenic
979143735 4:117213655-117213677 AATTTAATTAGCATTTTTCTAGG - Intergenic
979503236 4:121463763-121463785 AATACATTTCTTATTTTTCTTGG + Intergenic
979664131 4:123292513-123292535 AATTTATTTTTTATTCTACTGGG + Intronic
979704512 4:123706227-123706249 AATTTATTTTTTATTTTAGTAGG + Intergenic
979857689 4:125653943-125653965 AATTCCTTTATTATTGTGCTTGG + Intergenic
980079667 4:128330629-128330651 AATTCATTTTGTTTTTAAATTGG + Intergenic
980122938 4:128746244-128746266 ATTTCATTTAGAATTTGATTTGG + Intergenic
980302108 4:131008816-131008838 AATTAATTTATTGTTTTACTTGG + Intergenic
980434987 4:132759250-132759272 AATTAACATATTATTTTACTTGG + Intergenic
980710714 4:136563684-136563706 AACTTATTTAGTAATTTTCTTGG - Intergenic
980826160 4:138076038-138076060 ATTTCATTTAGAATCTTATTAGG + Intergenic
980918499 4:139057631-139057653 AATGAATTTAGTATTTTAGTTGG - Exonic
980953141 4:139401353-139401375 AATTCATTTAATCATTTCCTAGG - Intronic
980986684 4:139701989-139702011 ATTAAATTTATTATTTTACTTGG - Intronic
981293067 4:143099217-143099239 AATTCATTATGTCTTTTGCTGGG - Intergenic
981870131 4:149475797-149475819 AATTCTGTTATTATTTTACTTGG - Intergenic
982187933 4:152820985-152821007 AATTTATTTTTTATTGTACTGGG - Intronic
982355879 4:154467621-154467643 AATATATTAAGTATTATACTTGG - Intronic
982680664 4:158425224-158425246 TATTCATTTTCTATGTTACTGGG + Intronic
982732274 4:158969064-158969086 AATTGATTTAATATTTTCTTTGG + Intronic
982923734 4:161308506-161308528 AATTTATTTACTATTTTATATGG + Intergenic
983755666 4:171331578-171331600 AATTCATTTTGTATAGTATTTGG - Intergenic
984047655 4:174821347-174821369 TATTTATTTTGAATTTTACTAGG - Intronic
984081983 4:175258482-175258504 TATTCATTTGCTATTTAACTTGG - Intergenic
984135384 4:175931237-175931259 TATTTATTTAATATTTTTCTAGG - Intronic
984201758 4:176730521-176730543 AATTGATGTTGTATTTTACTTGG - Intronic
984421980 4:179535200-179535222 AGTTCATTTAGTATCTAACAAGG + Intergenic
984568613 4:181362479-181362501 ATTTCTTTTAATTTTTTACTTGG + Intergenic
1202752698 4_GL000008v2_random:23447-23469 CATTCACTTATTATTTTACAAGG - Intergenic
1202765012 4_GL000008v2_random:142047-142069 AACTCATGTAGAATTTTAATGGG - Intergenic
986040908 5:3993224-3993246 AACCAATTTACTATTTTACTGGG - Intergenic
986754797 5:10825251-10825273 AATTTATTTGGTATTTTAATAGG - Intergenic
986948402 5:13051855-13051877 TATACATTTAATATTTTGCTTGG + Intergenic
987028927 5:13957555-13957577 AATTATTTTATTATTTAACTTGG - Intergenic
987145207 5:14984977-14984999 AAGTCATGTATTATTATACTTGG + Intergenic
987871580 5:23625525-23625547 ATTTTATTTAGAATTTTAATGGG + Intergenic
987898353 5:23978370-23978392 ACTGCATTTTGTATTTTTCTAGG + Intronic
988019430 5:25604949-25604971 AATCACTTTAGTATTTTAATAGG - Intergenic
988056693 5:26106294-26106316 TTTTGATTTAGTATTTTTCTAGG + Intergenic
988266696 5:28960919-28960941 TTTTCATTTACTATTTTAGTAGG + Intergenic
988426167 5:31067396-31067418 AATACATTCAGTATTTTTTTGGG - Intergenic
988904884 5:35776392-35776414 AAGTCATGTAGTACTTTACCTGG - Exonic
989419707 5:41222883-41222905 AATTCATTTAGCCTTTTAAATGG + Intronic
989459142 5:41677121-41677143 AATGCATTAACTATTTTCCTGGG + Intergenic
989555961 5:42795054-42795076 AATGCATTTAGTAATATATTTGG - Intronic
989738934 5:44746157-44746179 AATTGATTTTGTATGCTACTGGG - Intergenic
990106152 5:52264494-52264516 AATCCCATTAGTATTTTGCTTGG - Intergenic
990687259 5:58319220-58319242 CATTCATTTAGTCATTCACTCGG + Intergenic
990754519 5:59053961-59053983 AATTCATCCACTATTTCACTAGG + Intronic
991083179 5:62623377-62623399 CAATTATTTAGTATTTTTCTAGG + Intronic
991317829 5:65330062-65330084 ATTTCTTTTAGTATTTTAATAGG + Intronic
992135081 5:73736499-73736521 AATTCACTTAGAATGGTACTTGG + Intronic
992293450 5:75304102-75304124 TATTCAGTTAGATTTTTACTAGG - Intergenic
993199007 5:84788493-84788515 AATTCAAATAGTATGTTTCTAGG - Intergenic
993209069 5:84924027-84924049 AATTCATTTATAATTTTATGAGG - Intergenic
993267651 5:85746935-85746957 GATACATTTAGTATTTTATATGG + Intergenic
993493561 5:88582057-88582079 ATTTTATTAAGTATGTTACTTGG - Intergenic
993865604 5:93191040-93191062 AATTAATTTAAAATTTTGCTTGG - Intergenic
993912859 5:93705282-93705304 AATTCACTTAGTATTTTAAAAGG + Intronic
994323414 5:98420266-98420288 AATTCCTTTATTACTTGACTTGG - Intergenic
994931877 5:106198967-106198989 AAAACTTTTAGTATTTTACAAGG + Intergenic
995087540 5:108131900-108131922 ATTCAATTTAGTATTCTACTAGG + Intronic
995518019 5:112973574-112973596 ATTTCATTTAGTCTTTTTTTTGG - Intergenic
995635045 5:114178610-114178632 AATTCATTTAGCCTTTTAGTGGG + Intergenic
995787010 5:115841379-115841401 AATTCAGTTACTTTTTTTCTTGG + Exonic
996294007 5:121890315-121890337 AATTGATTCAGGATTTTTCTTGG + Intergenic
996313373 5:122133182-122133204 AATTTATTCAGTAATTTATTGGG + Intronic
996377767 5:122831827-122831849 AAAATATTTATTATTTTACTTGG - Intergenic
996916445 5:128717903-128717925 AATTCTTTTAGTATTTTTATTGG + Intronic
998999199 5:147901291-147901313 AACTCAGTTGCTATTTTACTAGG - Intronic
999798476 5:155010143-155010165 AAATCATTAAGTATTCTTCTAGG + Intergenic
999909311 5:156180015-156180037 AATATTTATAGTATTTTACTTGG + Intronic
999923730 5:156351959-156351981 AATGCATTTAGTGGTATACTGGG - Intronic
1000392253 5:160736251-160736273 TTTTCATTTATTATTTTATTTGG - Intronic
1000422985 5:161059034-161059056 AATTGATTTACTATGTTTCTAGG + Intergenic
1000598202 5:163240314-163240336 ATTTCATTTTGTATTTTAACTGG + Intergenic
1003775903 6:9363684-9363706 ATTTCATTAAGTATATTATTAGG + Intergenic
1004776550 6:18852598-18852620 AATGCATTTAGCTTATTACTTGG - Intergenic
1005720521 6:28597226-28597248 GATACATTTAGTAATTTACTTGG + Intronic
1005916100 6:30352828-30352850 AATTCTTTTAGAGTTTTACCTGG + Intergenic
1006265689 6:32921045-32921067 TATTTAGTTAATATTTTACTTGG - Intergenic
1007577242 6:42933213-42933235 AAGGCATTAAGTATTTTCCTAGG + Intronic
1008024572 6:46619871-46619893 AATTCATCCATTATTTTACTTGG - Intronic
1008321494 6:50119646-50119668 AACTCATTTAGCATAATACTTGG - Intergenic
1009197637 6:60705951-60705973 GCTTCATTTATTATTTTTCTGGG - Intergenic
1009599686 6:65782729-65782751 AATTCATTAATTATTTCCCTAGG + Intergenic
1009838998 6:69042460-69042482 GATGCCTTTAGTATTTTACAAGG + Intronic
1009984150 6:70762618-70762640 AATTCACTTTGTAGTGTACTTGG + Intronic
1010157363 6:72810407-72810429 AATTCATGTGGTATGTTGCTGGG + Intronic
1010508288 6:76687114-76687136 AAATCATTTAAGATTTTAGTAGG - Intergenic
1010536016 6:77031592-77031614 AATTTATTTAGTAATTTAACAGG - Intergenic
1011040400 6:83023864-83023886 AATTTATTTTTTATTTTAATAGG - Intronic
1011082245 6:83502305-83502327 AATTAATTATGTATTTAACTAGG - Intergenic
1011342581 6:86333518-86333540 AATTCATTTATTAGTTTTATTGG - Intergenic
1011648912 6:89487589-89487611 AATTCATTTCATATTGTTCTGGG + Intronic
1011794781 6:90940504-90940526 TACTCATTTAATATTTTGCTTGG - Intergenic
1011865017 6:91815076-91815098 ATTTCCATTAGTATTTTTCTTGG + Intergenic
1011875229 6:91951430-91951452 TATTTATTTAGTATTTTATTGGG - Intergenic
1012114004 6:95270577-95270599 ATTTCATCTTGTATTTTATTTGG - Intergenic
1012634898 6:101525630-101525652 CATTCATATAGTTTTATACTTGG + Intronic
1012749023 6:103133368-103133390 AATATATTCAATATTTTACTGGG + Intergenic
1012967901 6:105695469-105695491 AAATCATATAGTATGTTACAGGG + Intergenic
1014378451 6:120707513-120707535 AATGCATAGAGTATTTCACTGGG + Intergenic
1014416856 6:121194354-121194376 TTTTGATTTAGTATTTTTCTAGG - Intronic
1014427535 6:121327024-121327046 GCTTCATTTAGTATTTTATGGGG - Intronic
1014558363 6:122860892-122860914 AAGTCATTTAGTATTTGGGTGGG + Intergenic
1014727079 6:124984137-124984159 AAATCATTTTGTATTTTTATAGG + Intronic
1015475623 6:133656450-133656472 ATTTTATTTACTATTTTTCTAGG - Intergenic
1015648903 6:135431397-135431419 AATTCTTTGACTGTTTTACTGGG - Intronic
1015699994 6:136025307-136025329 ATTTTATTTAGCATTTTACATGG - Intronic
1015984668 6:138873035-138873057 CATTCATTTTGAATTTTATTTGG - Intronic
1016475211 6:144419682-144419704 ACTTTATTTAGTTTTTTACAAGG - Intronic
1016491955 6:144615257-144615279 AAGTCATTTCCTATATTACTTGG + Intronic
1016645539 6:146403549-146403571 ATTCCATTTAGAATTTCACTTGG - Intronic
1016929312 6:149387771-149387793 AGTTCATTTTGTATTCTTCTAGG + Intronic
1016959883 6:149663113-149663135 AATCCATTTAATATCGTACTTGG - Intronic
1018535145 6:164811506-164811528 ATTTGATTTACTATTTTTCTAGG + Intergenic
1019585731 7:1802096-1802118 AGTTTATTTAGGATTTAACTCGG - Intergenic
1019879670 7:3847404-3847426 AATTTATTTAGTATTTACCGAGG + Intronic
1020359489 7:7312986-7313008 AGTTCTTTTTGTATTTTGCTGGG + Intergenic
1020838261 7:13182154-13182176 AATTCATTTAGAATTATATATGG - Intergenic
1020889809 7:13864882-13864904 ACTTTCTTTAGTATTTCACTAGG - Intergenic
1021191590 7:17626516-17626538 AAATGATTAAGTAATTTACTAGG - Intergenic
1021270214 7:18575735-18575757 AATTGCTTTAGGATTTTAATCGG + Intronic
1021385706 7:20027441-20027463 AATTCATTTTGTAGTGTAATAGG + Intergenic
1022301360 7:29105653-29105675 ATTTAATTTATTTTTTTACTTGG + Intronic
1023620987 7:42072351-42072373 CATTCATTTTGGATTTTTCTTGG - Intronic
1023767585 7:43526062-43526084 TACTGATTTAGTATTTTATTTGG + Intronic
1024417527 7:49124403-49124425 AATTCATTTTTTATTTTAATAGG - Intergenic
1024849897 7:53700021-53700043 AATTTAGTTATTATTTTCCTGGG + Intergenic
1025974940 7:66362246-66362268 AATTCACCAAGTATTTTACTTGG - Intronic
1026543787 7:71304011-71304033 AGCTTATTTAGTATTTTAATTGG - Intronic
1026811078 7:73465750-73465772 ATTTCATATAATATTTTAATAGG - Intronic
1027767870 7:82367665-82367687 TATTCATTTAATATTTATCTAGG - Intronic
1028023171 7:85804134-85804156 AAGTCAGTTAGTCTGTTACTGGG + Intergenic
1028309706 7:89316251-89316273 AATTCTTTTAGAATTTTATTAGG - Intronic
1028673989 7:93437281-93437303 ACTTTATTTATTATTTTATTAGG + Intronic
1028754062 7:94414635-94414657 AATTCCTTTTGTGTTTTTCTTGG + Intronic
1028872354 7:95783194-95783216 AATGCATTTTATATTTTAATGGG - Intronic
1029810897 7:103047549-103047571 AATTAATTTTTTGTTTTACTTGG + Intronic
1030170409 7:106596373-106596395 AAATCAATTAATATTTTATTGGG - Intergenic
1030170422 7:106596778-106596800 AATTCCTTTATTTTTTTCCTAGG - Intergenic
1030241113 7:107326424-107326446 AATTCAGTTATTATTTTAACAGG - Intronic
1030730638 7:112983726-112983748 AATTCAGGAAGTATTTTACTTGG + Intergenic
1031069612 7:117147562-117147584 TTTTCATTTTGTATTTTATTTGG + Intronic
1031361070 7:120849185-120849207 AATACATTTAATATATTATTTGG + Intronic
1031755449 7:125636252-125636274 AATTAATTTGATATCTTACTTGG + Intergenic
1032139885 7:129318686-129318708 GTTTCTTTTAGTACTTTACTAGG - Intronic
1032335869 7:131023827-131023849 CATTCATTGAAGATTTTACTTGG - Intergenic
1034846231 7:154448201-154448223 AACTCATTTATTATTATAATAGG - Intronic
1034963941 7:155379929-155379951 AAATCATTTAGCAATTAACTTGG - Intergenic
1035112059 7:156491473-156491495 AATTTTTTTAATATTCTACTAGG + Intergenic
1036162260 8:6400281-6400303 ATTTCATTTAGAATTTCATTTGG - Intergenic
1037548726 8:19949445-19949467 AAATCCTTTAATATTTTAATAGG + Intronic
1037561906 8:20082935-20082957 AATTCCTTTTGTAATTGACTTGG - Intergenic
1038662396 8:29508380-29508402 AAAGCATTTAGGATTTTACAGGG - Intergenic
1038981793 8:32767515-32767537 AATACATATTGTATATTACTTGG + Intergenic
1038987193 8:32824660-32824682 ATTTCATTTAATATTTTATGGGG - Intergenic
1039023936 8:33237238-33237260 AAGTATTTTACTATTTTACTTGG + Intergenic
1039258115 8:35741172-35741194 GATTCCTTTAGTATATTAATTGG + Intronic
1039295854 8:36153363-36153385 ATTTCATTTAGTCTTCTATTTGG + Intergenic
1040989052 8:53329486-53329508 AATGTATTTAGTAATTTCCTGGG - Intergenic
1041567411 8:59295009-59295031 AATGTATTTAGTACTTTACATGG + Intergenic
1042075558 8:64990472-64990494 AATTTAGTTAGTATTTTAGCTGG + Intergenic
1042211363 8:66384052-66384074 AATTCAATTTGCATTTTATTGGG - Intergenic
1043348257 8:79325824-79325846 ATTTCTTTAATTATTTTACTAGG - Intergenic
1044129770 8:88506752-88506774 AATTCTTTTAGTTTTTGTCTAGG - Intergenic
1044202263 8:89451437-89451459 TTTTGATTTAGTATTTTTCTAGG - Intergenic
1044340225 8:91038611-91038633 CATTCATTTATTAATTTATTGGG - Intronic
1044342519 8:91063342-91063364 AGTTCAGTTTGTATGTTACTGGG - Intergenic
1044487280 8:92768164-92768186 TTTTCATTTACTATTTTTCTAGG + Intergenic
1044709878 8:95046728-95046750 AACACATTTAGAATTTTAATCGG - Intronic
1044854785 8:96464260-96464282 AATTCAGTCAGTATATTAATGGG + Intergenic
1045735168 8:105287342-105287364 AATTTATTTCATATTATACTAGG + Intronic
1046185001 8:110701949-110701971 AATTGATTTAGTATTTACTTAGG + Intergenic
1046343290 8:112887857-112887879 AACTCAGTTAGTATTCTACTTGG + Intronic
1047180742 8:122585284-122585306 AAGTAATTGTGTATTTTACTTGG - Intergenic
1047893778 8:129342923-129342945 AATAGGTTTAGTAGTTTACTTGG - Intergenic
1048676122 8:136783075-136783097 GATTCATTTATTATTTTATTGGG - Intergenic
1049530609 8:143152733-143152755 ATTTCATTTAGCTTTTTATTAGG - Intergenic
1050040311 9:1485279-1485301 TATCCATTTTGTATATTACTGGG + Intergenic
1050818806 9:9851608-9851630 TATTCATTTATAATTTCACTGGG + Intronic
1050884707 9:10749871-10749893 TATTCATTTAGTATTGTGCTAGG + Intergenic
1051002406 9:12300353-12300375 GATCCATTTAATATTTTCCTCGG + Intergenic
1051021546 9:12549697-12549719 AATATATTTTGTCTTTTACTGGG - Intergenic
1051521918 9:17998936-17998958 AATTCATTTATTTTTTTAAAGGG + Intergenic
1052435368 9:28421040-28421062 AAGCCATTTAGTATTTACCTTGG - Intronic
1053611622 9:39719440-39719462 AATACATGAATTATTTTACTGGG - Intergenic
1053869655 9:42477488-42477510 AATACATGAATTATTTTACTGGG - Intergenic
1054086633 9:60751720-60751742 AATACATGAATTATTTTACTGGG + Intergenic
1054241899 9:62622949-62622971 AATACATGAATTATTTTACTGGG + Intergenic
1054556023 9:66657463-66657485 AATACATGAATTATTTTACTGGG + Intergenic
1055618451 9:78097819-78097841 AATTCGTTTCCTATTTTTCTAGG + Intergenic
1057301127 9:93883660-93883682 AAGACATTTAGAATTTTATTAGG - Intergenic
1058040725 9:100298701-100298723 TATTCATTTAGTTTTTTGATGGG + Intronic
1058424871 9:104867690-104867712 AATAAATCTAGTATTTTACAGGG + Intronic
1058781635 9:108342351-108342373 AAGTCCTTTAGGATTTTAATTGG + Intergenic
1059159508 9:112020671-112020693 CATTCATTTAGTAGTTTCCTAGG + Intergenic
1059234830 9:112752065-112752087 AATTCATTTAGTATTTTACTAGG - Intronic
1060427432 9:123518448-123518470 AACTCAATTAGCATTTTACTGGG - Intronic
1060459164 9:123832746-123832768 AGTGTATTTAATATTTTACTTGG - Intronic
1203524675 Un_GL000213v1:75723-75745 AATTCTTTTAGTATATTAACTGG - Intergenic
1203758372 Un_GL000218v1:157407-157429 CATTCACTTATTATTTTACAAGG + Intergenic
1203717736 Un_KI270742v1:170080-170102 CATTCACTTATTATTTTACAAGG + Intergenic
1203533488 Un_KI270743v1:8151-8173 CATTCACTTATTATTTTACAAGG - Intergenic
1203545761 Un_KI270743v1:126936-126958 AACTCATGTAGAATTTTAATGGG - Intergenic
1203651956 Un_KI270751v1:133667-133689 CATTCACTTATTATTTTACAAGG + Intergenic
1186549166 X:10483980-10484002 AATGCATTAAGTCTTTTACCAGG - Intronic
1186997251 X:15136869-15136891 CATTCATTTATTATTTCAATAGG - Intergenic
1187089068 X:16075052-16075074 TATTCATTTACTACTTTACAAGG + Intergenic
1188080048 X:25828062-25828084 AATTAATTTATTTTTTTGCTAGG + Intergenic
1188478826 X:30616372-30616394 AATTCTCTTAGTATTTTTTTGGG - Intergenic
1188489322 X:30721090-30721112 ATAACATTTACTATTTTACTTGG - Intronic
1188766203 X:34095233-34095255 CCTTCATTTAGTGTATTACTAGG - Intergenic
1188775236 X:34208614-34208636 AATGTATTTATTATTTTAATTGG + Intergenic
1189511207 X:41663378-41663400 AATTTATTTACTTTTTTACTTGG - Intronic
1189569730 X:42283753-42283775 AACCCATTTATTATTTCACTGGG + Intergenic
1190361197 X:49650244-49650266 ATTTCATTTAGAATTTCATTTGG + Intergenic
1191008425 X:55736623-55736645 AATTTATTTCTGATTTTACTGGG + Intronic
1192778599 X:74270862-74270884 AATTAATTTGGTAAATTACTAGG - Intergenic
1193873207 X:86827593-86827615 AATTAATGTATTATTTTATTAGG - Intronic
1193893001 X:87074648-87074670 AATCCATTTATTAATTTTCTGGG - Intergenic
1194167637 X:90539494-90539516 AATTAATTTATTATAATACTGGG - Intergenic
1194169881 X:90567819-90567841 AATTAATTTAGTTTTCTATTAGG + Intergenic
1194277232 X:91900373-91900395 AATTCTTCTAGTAGGTTACTAGG + Intronic
1194432531 X:93827332-93827354 AATTCATCTGGGATTTTAATTGG + Intergenic
1194832391 X:98640126-98640148 AATGCAATTGGGATTTTACTGGG - Intergenic
1195566223 X:106342402-106342424 AGTTCATTTAATAGTTTACCTGG + Intergenic
1196196861 X:112845947-112845969 AAATCATTTAGTTGTTCACTAGG - Intergenic
1196303710 X:114075642-114075664 AATTGATTTACTATGTCACTCGG - Intergenic
1196702629 X:118687991-118688013 AGTTAATTTTGTATTTTAATAGG + Intergenic
1197136229 X:123062827-123062849 AATTCATTTAGAATTATATAAGG + Intergenic
1197817800 X:130516464-130516486 TATTCATTGAGTCTTTTATTGGG + Intergenic
1197954744 X:131933813-131933835 AGTTAATATAGTATTTTACATGG - Intergenic
1198545101 X:137683425-137683447 AATTCATTTAGGATCTTAGCGGG - Intergenic
1198554734 X:137781005-137781027 AATTCATTATGTATTTCAATGGG + Intergenic
1198717854 X:139580576-139580598 AATTCATTTATTATTTAGGTTGG - Intergenic
1200513890 Y:4117275-4117297 AATTAATTTATTATAATACTGGG - Intergenic
1200516123 Y:4145593-4145615 AATTAATTTAGTTTTCTATTAGG + Intergenic
1200523710 Y:4245747-4245769 AATTTAATTAGAATTTTAATTGG + Intergenic
1200594576 Y:5122472-5122494 AATTCTTCTAGTAGGTTACTGGG + Intronic
1201171899 Y:11275014-11275036 CATTCACTTATTATTTTACAAGG + Intergenic
1201538010 Y:15072242-15072264 TATTCTGTTATTATTTTACTTGG - Intergenic
1201684844 Y:16689524-16689546 AATGCATCTTGTGTTTTACTTGG + Intergenic
1201777001 Y:17676820-17676842 ACTCCTTCTAGTATTTTACTGGG + Intergenic
1201824556 Y:18229172-18229194 ACTCCTTCTAGTATTTTACTGGG - Intergenic
1201853778 Y:18518386-18518408 AATTAATTTATTTTTTTAATTGG + Intergenic
1201879543 Y:18801998-18802020 AATTAATTTATTTTTTTAATTGG - Intronic