ID: 1059234832

View in Genome Browser
Species Human (GRCh38)
Location 9:112752088-112752110
Sequence CCCCCTTGTCCCAATATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059234830_1059234832 0 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT 0: 1
1: 0
2: 4
3: 50
4: 589
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data
1059234829_1059234832 1 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT 0: 1
1: 0
2: 4
3: 44
4: 513
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059234832 Original CRISPR CCCCCTTGTCCCAATATTAA TGG Intronic
No off target data available for this crispr