ID: 1059234832

View in Genome Browser
Species Human (GRCh38)
Location 9:112752088-112752110
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059234829_1059234832 1 Left 1059234829 9:112752064-112752086 CCCTAGTAAAATACTAAATGAAT No data
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data
1059234830_1059234832 0 Left 1059234830 9:112752065-112752087 CCTAGTAAAATACTAAATGAATT No data
Right 1059234832 9:112752088-112752110 CCCCCTTGTCCCAATATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type