ID: 1059234834 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:112752089-112752111 |
| Sequence | CCCCTTGTCCCAATATTAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1059234829_1059234834 | 2 | Left | 1059234829 | 9:112752064-112752086 | CCCTAGTAAAATACTAAATGAAT | No data | ||
| Right | 1059234834 | 9:112752089-112752111 | CCCCTTGTCCCAATATTAATGGG | No data | ||||
| 1059234830_1059234834 | 1 | Left | 1059234830 | 9:112752065-112752087 | CCTAGTAAAATACTAAATGAATT | No data | ||
| Right | 1059234834 | 9:112752089-112752111 | CCCCTTGTCCCAATATTAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1059234834 | Original CRISPR | CCCCTTGTCCCAATATTAAT GGG | Intronic | ||