ID: 1059237682

View in Genome Browser
Species Human (GRCh38)
Location 9:112776115-112776137
Sequence AGGGCCCACTGGATTTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059237682 Original CRISPR AGGGCCCACTGGATTTTGAG TGG (reversed) Intronic
901723069 1:11215993-11216015 AAAGCCCACTGGATTTTGAGGGG - Intronic
902151002 1:14443311-14443333 AGGGGCCACTGGATCTTCAAAGG + Intergenic
907208964 1:52801847-52801869 AGTGTCCACTGAATTTTGATTGG - Exonic
908474238 1:64471925-64471947 AAGGCCCACTAGATTAGGAGAGG + Intronic
909568907 1:77085903-77085925 AGAGGACACAGGATTTTGAGAGG + Intergenic
911507507 1:98771841-98771863 AGGGCCCACTGTATAATGTGTGG - Intergenic
919801036 1:201354816-201354838 AGGGCAGACTGGACTTTCAGAGG + Intergenic
921694525 1:218192314-218192336 AGGGCTCAGTGGATATTGAGTGG - Intergenic
922576759 1:226665983-226666005 GCGGCCAACTGCATTTTGAGGGG + Intronic
923012128 1:230096134-230096156 GGGGCCCTTTTGATTTTGAGAGG + Intronic
924745111 1:246824645-246824667 AGGGCCCACTTGATAGTGATTGG + Intergenic
1064853206 10:19734049-19734071 AGGTCCCAATGGATTTTCACTGG - Intronic
1067288080 10:44921915-44921937 AGGGCCCCCTTAATTTTAAGAGG + Intronic
1067467034 10:46508816-46508838 AGGGGCCACTGGATCTTGTCTGG - Intergenic
1067620152 10:47875789-47875811 AGGGGCCACTGGATCTTGTCTGG + Intergenic
1071233918 10:83622130-83622152 GGGGCCCACAGAATTTTTAGAGG + Intergenic
1074301265 10:112235103-112235125 AGGGGCCAGTGGACTTCGAGGGG + Intergenic
1078004885 11:7525153-7525175 AGGGCCCACAGGAGTTAGGGAGG - Intronic
1078427578 11:11264537-11264559 TGAGCTCACTGGATTATGAGTGG - Intergenic
1081371883 11:42314161-42314183 CTGGCCCACTGGATTTTAAATGG - Intergenic
1081695947 11:45109188-45109210 AGGGCCAACTGCAGTTTCAGAGG - Intronic
1083075942 11:60037905-60037927 AGGGACCAGTGGATTTTAATGGG - Intergenic
1084673866 11:70623196-70623218 AGGCCCCACAGGATGTGGAGAGG - Intronic
1084725293 11:70937876-70937898 AAGGCCCTCTGGCTTCTGAGAGG - Intronic
1085554961 11:77411670-77411692 GGGGTCCAGTAGATTTTGAGGGG - Intronic
1087796567 11:102460616-102460638 GTGGCCTACTGGCTTTTGAGGGG + Intronic
1091579417 12:1773952-1773974 AGGGTCCAGTGGGTTTTCAGGGG + Intronic
1093338066 12:17934109-17934131 AGGACCAACTGAATTTTAAGAGG - Intergenic
1100400589 12:94225828-94225850 AGGACACACTGGCTTTTGCGTGG - Intronic
1103637901 12:122323544-122323566 GGAGCCCACTGGCTTCTGAGCGG + Intronic
1103989387 12:124788275-124788297 AGGGACCAATGGATTTTGGCTGG - Intronic
1108668301 13:52654109-52654131 AGGGCCCATTTGATTAAGAGAGG + Intronic
1109585178 13:64391601-64391623 ATGGACCACTGCATTTTGGGAGG + Intergenic
1110249937 13:73370388-73370410 TAGACCCACTGAATTTTGAGTGG - Intergenic
1111234683 13:85393394-85393416 AGAACCCTCTGGATTTTGAGTGG + Intergenic
1116443185 14:44978240-44978262 AGGGCACAGTGGAATTTGGGAGG - Intronic
1117463191 14:55967119-55967141 AGGGCCCACAAGACTTTTAGGGG + Intergenic
1119425091 14:74529873-74529895 AGGGCTGACTGGATTCTAAGAGG + Intronic
1122152735 14:99733471-99733493 AGGGCCCACAGGCTTGTGGGTGG - Intergenic
1122581488 14:102774521-102774543 AGGGGCCAGTGGTTTTTGTGTGG + Intergenic
1123083703 14:105707776-105707798 TGGACCCACCGGATTTTGAGAGG + Intergenic
1123493937 15:20804635-20804657 AGGGACCACTGGACATCGAGTGG - Intergenic
1123550436 15:21373717-21373739 AGGGACCACTGGACATCGAGTGG - Intergenic
1128931411 15:71707949-71707971 AGAGCAAACTGGATTTTAAGAGG - Intronic
1129387989 15:75206503-75206525 AGAGGCCACTGGATGTTGACTGG + Exonic
1129947551 15:79553219-79553241 AGGGCTCACTAAATCTTGAGAGG + Intergenic
1131306998 15:91253762-91253784 GGGGGCCACTGGAATGTGAGCGG - Intronic
1132379924 15:101359239-101359261 AGGGCCTACTGGAATTTGGGGGG - Intronic
1202958779 15_KI270727v1_random:100971-100993 AGGGACCACTGGACATCGAGTGG - Intergenic
1132508092 16:322557-322579 AGGTCCCACTTGCTTTGGAGAGG - Intronic
1133569242 16:7025328-7025350 AGGGCCATCTGGGTTTTGATGGG + Intronic
1134556591 16:15170987-15171009 AGGGCCCAGGGCATGTTGAGAGG - Intergenic
1137250425 16:46737039-46737061 AGGGCCCTCAGGAATGTGAGAGG - Intronic
1137545918 16:49403326-49403348 AGGCCCCTCTGGCTTCTGAGAGG + Intergenic
1142029466 16:87831378-87831400 CGGGCCCACTGGATGGTGAGGGG + Exonic
1144024578 17:11266773-11266795 AGGGCCCATGGGATTGTGTGTGG + Intronic
1144779050 17:17798804-17798826 GGGGCCCAGTGGATTCTGGGTGG - Intronic
1145859299 17:28194099-28194121 ATAGGCCACTGTATTTTGAGAGG + Intronic
1147623545 17:41884358-41884380 TGGGTACACTGGATTTTGGGGGG + Intronic
1150125000 17:62629658-62629680 AGGGCCCAGTGGAATTTGGCAGG - Intronic
1152311838 17:79556236-79556258 AGTGCTCACTGGTGTTTGAGGGG - Intergenic
1153374707 18:4362930-4362952 AGGGCCAACTTGACTTGGAGAGG + Intronic
1154451458 18:14479097-14479119 AGGGACCACTGGACATCGAGTGG - Intergenic
1156359414 18:36371139-36371161 GGGGCTCATTGAATTTTGAGGGG + Intronic
1157521896 18:48351291-48351313 AGAGTCCAGGGGATTTTGAGTGG - Intronic
1157575361 18:48739702-48739724 AGGGGCCACTGGAAGCTGAGAGG + Intronic
1160528329 18:79549824-79549846 AGGCCCCACTGGACTGTGACGGG + Intergenic
1162569027 19:11460201-11460223 AGAGCCTACAGGATTTAGAGTGG - Intronic
1166367641 19:42285401-42285423 AGGGCCCAGCGGGTTTTCAGGGG + Intronic
1166540192 19:43600000-43600022 AGGGAGCTCTGGCTTTTGAGTGG + Exonic
928313041 2:30225997-30226019 AGGGACCACTGGCTTTAGGGTGG + Intergenic
929780459 2:44953823-44953845 GGGGCCCATGGGTTTTTGAGAGG + Intergenic
934567382 2:95348107-95348129 AGAGCCCAGTGGCTTCTGAGGGG - Intronic
934991154 2:98922500-98922522 AGAGCCCATTGTAGTTTGAGAGG - Intronic
939482107 2:142762013-142762035 AGTGACCACTGGGTCTTGAGTGG - Intergenic
942993604 2:182233386-182233408 AGGGGACACTAGATTTTGATAGG - Intronic
943524387 2:188998111-188998133 ATGTGTCACTGGATTTTGAGTGG + Intronic
943769983 2:191705661-191705683 GGGGCCCCCTGGATTGTGAAGGG + Intergenic
944260684 2:197673009-197673031 AGGGCACTGTGGATTTTCAGAGG + Intronic
946895286 2:224318077-224318099 AGGGCCATCTGGATTTTGGGGGG + Intergenic
1171131831 20:22661015-22661037 AAGGCTCACTGGATTTCAAGAGG + Intergenic
1172026942 20:31954996-31955018 AGGCCCTAGTGGATTTTGGGTGG - Intergenic
1175642972 20:60646905-60646927 AGGGCACTCTGGATTCAGAGTGG + Intergenic
1176444686 21:6811131-6811153 AGGGACCACTGGACATTGAGTGG + Intergenic
1176822851 21:13676169-13676191 AGGGACCACTGGACATTGAGTGG + Intergenic
1181133248 22:20746844-20746866 AGTGCCCTCTGGCTTTTGTGGGG - Intronic
1182299717 22:29330744-29330766 AGGGCCCACAGGTTTATGAGGGG - Intronic
1182553376 22:31114545-31114567 AGGGCCCACTATACTTTTAGGGG - Intronic
1183828838 22:40407501-40407523 AGGCCCTGCTGGACTTTGAGCGG + Exonic
1184015313 22:41781642-41781664 AGGGCCCACAGGAGTTACAGAGG - Intronic
1184746090 22:46457088-46457110 AGGGCCCACAGCACTTTGGGAGG + Intronic
1185219725 22:49623319-49623341 AGGGCCTGCTGGATTTGCAGAGG - Intronic
950689913 3:14647400-14647422 CGACCCCACTGGATTTAGAGAGG - Intergenic
954759339 3:52862665-52862687 ATTGCCAACTAGATTTTGAGGGG - Intronic
959281620 3:104348532-104348554 CAGGACCACTGGATGTTGAGTGG - Intergenic
959799738 3:110478051-110478073 AGGACCCACTGACTTTTGGGTGG - Intergenic
960360491 3:116705306-116705328 AGGGGTCACTGAGTTTTGAGAGG - Intronic
960415773 3:117383264-117383286 ATGGGCCGCTGGATTTCGAGAGG + Intergenic
961478886 3:127166895-127166917 AGGGCCTAGTGGATTCAGAGAGG + Intergenic
961747887 3:129077172-129077194 AGGGCCAACTTTATTTTAAGTGG - Intergenic
962416477 3:135187189-135187211 TGGTCCCACTGGACTTTGATTGG - Intronic
965651660 3:170939691-170939713 AGGGGCCACAGGAATATGAGTGG - Intergenic
971259514 4:25043512-25043534 GGGGCCCACTGGGTTTGGTGAGG + Intergenic
974170118 4:58255681-58255703 AGGGTTGACAGGATTTTGAGTGG + Intergenic
981998604 4:151001653-151001675 ATGACCCACTGGATCCTGAGTGG - Intronic
982356413 4:154474209-154474231 AGATCACACTGGATTTAGAGTGG - Intronic
985271216 4:188196797-188196819 ACAACCCACTGGACTTTGAGAGG + Intergenic
986402026 5:7392124-7392146 AGAGCCCTGTGGATGTTGAGAGG + Intergenic
987198820 5:15554116-15554138 AGGGCAGACTGGATATGGAGTGG - Intronic
989155264 5:38338805-38338827 AGTGCCCACATGCTTTTGAGTGG - Intronic
992111424 5:73498168-73498190 AGGGCCCAATGGAGACTGAGCGG + Intergenic
992639962 5:78760787-78760809 AGTGCCCATTGGATTTGGTGAGG - Intronic
998019377 5:138756563-138756585 AGGGCCCTCTGCATTTGTAGAGG + Intronic
999301314 5:150492381-150492403 AGGGCCCGCTGCTTTCTGAGGGG + Intronic
999410977 5:151349508-151349530 AGGGGACACTGGAGTTTGAAGGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000221917 5:159222643-159222665 AGGGACCACTGGATTTGGTGAGG - Intergenic
1005978780 6:30820102-30820124 AGGGCCCACTGGATTTGGCGTGG + Intergenic
1008858577 6:56121403-56121425 AGAGCCCACAGGATTTTTAAGGG + Intronic
1009508758 6:64520495-64520517 AGGGGGAACTTGATTTTGAGTGG + Intronic
1012246638 6:96933462-96933484 AGGGCTCACTTAATGTTGAGAGG - Intronic
1013729846 6:113152454-113152476 AGGGCCTACTGGAGGTTGAGGGG + Intergenic
1014544127 6:122712945-122712967 GGGGCCCACTGGGTTCTGACTGG + Intronic
1017516850 6:155164236-155164258 AGGACCCAATGCATTTTGATGGG + Intronic
1018370258 6:163161835-163161857 AGCAGCCCCTGGATTTTGAGAGG - Intronic
1019211425 6:170408445-170408467 AGGGCTCACTGGATTTAAGGTGG - Intergenic
1023943823 7:44787488-44787510 AGGGTCAACTGTATTTTGATTGG - Intergenic
1024866633 7:53910660-53910682 AGGACCCCCTGGTTTTGGAGAGG - Intergenic
1027680554 7:81215163-81215185 AGGGACCTCTGAATTTTTAGTGG + Intergenic
1027947689 7:84770179-84770201 AGGGCTCACTGAATTCTGAAAGG - Intergenic
1028657254 7:93222824-93222846 AGGGCCCAGAGAGTTTTGAGAGG + Intronic
1028749135 7:94362722-94362744 AATGCCCATTGGATTTAGAGAGG + Intergenic
1030322323 7:108182285-108182307 AGGGCTGACTGTATTTTGGGGGG - Intronic
1034679396 7:152917138-152917160 GGAGCCCACGGGATTTTTAGGGG - Intergenic
1035665613 8:1377629-1377651 AGGGCACACTGGGTTCTGACAGG - Intergenic
1040314379 8:46253282-46253304 AGGGGCTTCTGGGTTTTGAGAGG - Intergenic
1042691060 8:71499224-71499246 AGGACCAACTGGATTTAGTGAGG - Intronic
1044443924 8:92251703-92251725 ACGCCACACTGGATTTTGGGTGG + Intergenic
1044605606 8:94044765-94044787 AGAGGCCTGTGGATTTTGAGTGG + Intergenic
1047873869 8:129113953-129113975 CAGGCCCACTGGCTTTTGAAAGG - Intergenic
1049029353 8:140023011-140023033 AGGGCCCACTGGAGGAGGAGGGG + Intronic
1049129089 8:140820783-140820805 AGGGCCCAGTGGAGTTCAAGGGG + Intronic
1049441002 8:142609829-142609851 GGGGGGCACTGGATTCTGAGGGG - Intergenic
1049441017 8:142609881-142609903 TGGGGACACTGGATTCTGAGGGG - Intergenic
1051528350 9:18072721-18072743 AGGGCCCACTTCGTTTTGAAGGG + Intergenic
1051541667 9:18226761-18226783 AGGGCCCATTATACTTTGAGGGG + Intergenic
1057309292 9:93931779-93931801 AGGGTCTTCTGGATTTTAAGTGG - Intergenic
1059237682 9:112776115-112776137 AGGGCCCACTGGATTTTGAGTGG - Intronic
1062020865 9:134318832-134318854 AGGGCATCCTGGACTTTGAGGGG - Intronic
1203524512 Un_GL000213v1:73396-73418 AGGGACCACTGGACATTGAGTGG - Intergenic
1188457683 X:30385855-30385877 AGGCCGCACAGGATTTAGAGTGG + Intergenic
1190427796 X:50348900-50348922 ACGGCCCACTGGATTTCCATGGG - Intronic
1196059105 X:111388359-111388381 AGGCACCACTGCATTTTGATAGG - Intronic
1200182048 X:154156557-154156579 AGGGCACACGGTATTTTGAGTGG - Intronic
1200187701 X:154193671-154193693 AGGGCACACGGTATTTTGAGTGG - Intergenic
1200193351 X:154230811-154230833 AGGGCACACGGTATTTTGAGTGG - Intronic
1200199106 X:154268615-154268637 AGGGCACACGGTATTTTGAGTGG - Intronic
1200654927 Y:5889886-5889908 AGAGCCCACAGGGTTTTGTGTGG + Intergenic
1200696370 Y:6364631-6364653 CAGCCCCACTGGCTTTTGAGTGG - Intergenic
1201037744 Y:9800069-9800091 CAGCCCCACTGGCTTTTGAGTGG + Intergenic