ID: 1059240960

View in Genome Browser
Species Human (GRCh38)
Location 9:112804912-112804934
Sequence CATTGTACACACATGCTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059240960_1059240962 -2 Left 1059240960 9:112804912-112804934 CCAAGAAGCATGTGTGTACAATG 0: 1
1: 0
2: 1
3: 9
4: 156
Right 1059240962 9:112804933-112804955 TGGAGACTTACATCACCTATAGG 0: 1
1: 0
2: 0
3: 13
4: 96
1059240960_1059240964 15 Left 1059240960 9:112804912-112804934 CCAAGAAGCATGTGTGTACAATG 0: 1
1: 0
2: 1
3: 9
4: 156
Right 1059240964 9:112804950-112804972 TATAGGATCACCACCAAAGTAGG 0: 1
1: 0
2: 0
3: 9
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059240960 Original CRISPR CATTGTACACACATGCTTCT TGG (reversed) Exonic
901431972 1:9221887-9221909 CAAGGTACACACATGCTTCACGG + Intergenic
901988855 1:13096204-13096226 CATGGGACATGCATGCTTCTGGG - Intergenic
901992958 1:13130563-13130585 CATGGGACATGCATGCTTCTGGG + Intergenic
902947453 1:19852073-19852095 CATTGACCCCACATGCTCCTTGG - Intergenic
909499645 1:76319856-76319878 CATGGTACAGACATGCTGGTAGG - Intronic
911204554 1:95079318-95079340 CATTTCAAACACATGCTTTTTGG - Intergenic
913380274 1:118202879-118202901 CAGTGGACAGTCATGCTTCTGGG + Intergenic
916887006 1:169079404-169079426 CACTGTCTACACGTGCTTCTTGG - Intergenic
917237755 1:172912966-172912988 CAGTGTACCCTCATTCTTCTTGG - Intergenic
918315153 1:183317063-183317085 CATTTTAGAGACATTCTTCTGGG - Intronic
918634792 1:186763103-186763125 ATTTGTGCACACAAGCTTCTTGG - Intergenic
923693613 1:236223257-236223279 TATTGCACACAAATGCTTATAGG - Intronic
923923159 1:238592744-238592766 CAGAGTACACACATGCTTCAGGG - Intergenic
924724769 1:246659168-246659190 CACTGTGCACAGCTGCTTCTGGG - Intronic
1063933833 10:11056941-11056963 CCTTCTAACCACATGCTTCTGGG + Intronic
1068587380 10:58814439-58814461 TAATGTACACACATGCATCCAGG + Intronic
1070836987 10:79454228-79454250 CATTGCAGACCCATGGTTCTGGG + Intergenic
1071444993 10:85737214-85737236 CACTTAACACACATCCTTCTAGG - Intronic
1071792350 10:88968523-88968545 CATTTTGCACACATGTTTGTCGG + Intronic
1073351023 10:102819882-102819904 CTCTGTGCACACATGCTTCGTGG - Intergenic
1073549724 10:104386627-104386649 CATTCTACACACTGGCTTCTTGG + Intronic
1075130518 10:119734337-119734359 CATTGCCAACACATGTTTCTTGG + Intronic
1077596223 11:3534031-3534053 CATTGTCTACATATGCTTTTAGG + Intergenic
1079179043 11:18172378-18172400 CTGTGTACAAAAATGCTTCTAGG + Intronic
1079269808 11:18973562-18973584 CTGTGTACAAAAATGCTTCTAGG - Intergenic
1080075296 11:28140759-28140781 CATTTTACATACATGCTGATGGG + Intronic
1080140840 11:28918146-28918168 CATATCACACACATTCTTCTAGG + Intergenic
1081114951 11:39188967-39188989 CGTTGTACTCACATCTTTCTGGG - Intergenic
1081509487 11:43755017-43755039 CATTATACACAGAAGCTTCCTGG - Intronic
1085333949 11:75676459-75676481 CACTGTAGACTCAAGCTTCTGGG + Intergenic
1086075947 11:82852389-82852411 CAGTGTATACATATGCTTTTGGG - Intronic
1087206847 11:95405163-95405185 GTTTGTACACAAATGCTTATAGG - Intergenic
1087706292 11:101496311-101496333 CATTGGCCAACCATGCTTCTTGG + Intronic
1087959277 11:104327633-104327655 CATTGCACACATATGGTACTTGG + Intergenic
1089849216 11:121482015-121482037 CATAGTACACAGATGCCTATAGG + Intronic
1092147711 12:6226189-6226211 CTTTCTACACTCAGGCTTCTTGG + Intronic
1092545675 12:9449334-9449356 CATTCTACACACACACTCCTAGG + Intergenic
1093500278 12:19804253-19804275 TATTTTACATACATGTTTCTGGG + Intergenic
1094747296 12:33359650-33359672 CATTGTAGATATATGCTTGTAGG + Intergenic
1098858136 12:75677378-75677400 AAGTGTTCCCACATGCTTCTAGG + Intergenic
1098999244 12:77158502-77158524 CATTTTAAAAATATGCTTCTTGG + Intergenic
1100246824 12:92766539-92766561 CTTTTTAAAAACATGCTTCTGGG + Intronic
1100605815 12:96151155-96151177 TATTGGACACACCAGCTTCTTGG - Intergenic
1102189934 12:110980106-110980128 CATTGTACCATCATGCTACTGGG - Intergenic
1105242306 13:18619542-18619564 CACAGCACACACATGCTCCTGGG + Intergenic
1110259121 13:73465382-73465404 CATTGTACACACAAGTATATAGG - Intergenic
1110701138 13:78550552-78550574 CATTTTACACACCTGTTTTTTGG + Intergenic
1111069440 13:83145449-83145471 AATAGTAAACACATGGTTCTAGG - Intergenic
1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG + Intergenic
1111332083 13:86773087-86773109 AATTGTACACAAATGCTTTAGGG + Intergenic
1118165161 14:63328839-63328861 CAGTGTACACATCTGCTTCTTGG + Intergenic
1125252543 15:37722012-37722034 CATACTACATACAAGCTTCTGGG + Intergenic
1126546429 15:49879227-49879249 CATGGATCACACATGCTTCCAGG - Intronic
1128444129 15:67741631-67741653 CATGGAACACACGGGCTTCTTGG + Intronic
1130042045 15:80413342-80413364 TATTGTCCACACATCCTCCTAGG + Intronic
1133358225 16:5152804-5152826 CATGGGACACACAGGCTTGTGGG + Intergenic
1140714472 16:77709394-77709416 CAATGTACACACATACTTGCGGG + Intergenic
1144067922 17:11641115-11641137 CATTGGACTCACAGGCTTTTTGG + Intronic
1146091178 17:29880019-29880041 TACTGTATACACATGCTGCTAGG + Intronic
1146224320 17:31052429-31052451 CATTTTTCACACGTGCTCCTGGG + Intergenic
1150327805 17:64270781-64270803 CATTGTAGACAGAAGCTGCTTGG - Intergenic
1154352249 18:13594075-13594097 CATTTTATACACATGTGTCTTGG + Intronic
1154446643 18:14440336-14440358 CACAGCACACACATGCTCCTGGG - Intergenic
1158218055 18:55121249-55121271 CTTTGTTTACACATACTTCTTGG + Intergenic
1158967518 18:62635812-62635834 CATTGCACACCCAAGCATCTTGG - Intergenic
1160306687 18:77746802-77746824 AACTATACACACATGCTTATCGG + Intergenic
1163238199 19:16042062-16042084 CATTAAACTCATATGCTTCTTGG - Intergenic
1164839640 19:31382771-31382793 CATTTTACATTCAGGCTTCTTGG - Intergenic
1164961690 19:32436758-32436780 TTTTGTACACAGATGCTTCCTGG + Intronic
1166570283 19:43791481-43791503 TATTTTACACACATACTACTTGG + Intergenic
1167283082 19:48582438-48582460 CATTGAACACACTTACCTCTAGG + Intronic
927630441 2:24768878-24768900 GATTGTACACACAAGCTGCCTGG - Exonic
934097119 2:88616972-88616994 CATTCCAGAGACATGCTTCTGGG - Intronic
935656772 2:105429968-105429990 CATTTTACAGACGTGGTTCTGGG + Intronic
936859327 2:116997686-116997708 CAGAGTAGACCCATGCTTCTTGG - Intergenic
938483317 2:131679896-131679918 CACAGCACACACATGCTCCTGGG + Intergenic
940993680 2:160123827-160123849 ACTTGTCCACACATTCTTCTCGG + Exonic
943423547 2:187699424-187699446 CTTTGAACACACATGCTCCATGG - Intergenic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
946317295 2:218925122-218925144 CATGGTCAACACAAGCTTCTTGG + Intergenic
947005243 2:225504118-225504140 CATAGTACACTCAGGCTGCTAGG + Intronic
947129402 2:226905700-226905722 CATTCAACACACATTCATCTGGG + Intronic
947835769 2:233174298-233174320 CACATTACTCACATGCTTCTGGG - Intronic
1173223855 20:41150355-41150377 CATAGTACACTCAGGCTACTTGG - Intronic
1174286700 20:49479211-49479233 CATGGTACTCACATTCTTGTGGG + Intronic
1175229705 20:57465971-57465993 TAATGTACACAGAAGCTTCTTGG - Intergenic
1175612573 20:60363924-60363946 CATTGCAGACACATGCTCCCAGG + Intergenic
1175822809 20:61919573-61919595 CATGGTGCCCTCATGCTTCTTGG + Intronic
1176449336 21:6849505-6849527 CACAGCACACACATGCTCCTGGG + Intergenic
1176827504 21:13714529-13714551 CACAGCACACACATGCTCCTGGG + Intergenic
1176927296 21:14765773-14765795 AATTATAGACACATGCTCCTTGG + Intergenic
1177073739 21:16545613-16545635 CATTGCACCCTCATTCTTCTAGG + Intergenic
1183411602 22:37658247-37658269 CATCGTACACACACGTTTCTTGG + Intronic
1183910283 22:41074163-41074185 CATCGTCCACGAATGCTTCTAGG - Intergenic
1184570025 22:45316998-45317020 CATTGTAATCAGATGCTGCTTGG + Intronic
1184921202 22:47606953-47606975 CCATGCACACACATCCTTCTGGG - Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
951768896 3:26232467-26232489 CCATGTGCACACATGCTTCAGGG + Intergenic
951825198 3:26860463-26860485 CAATGTGTACACATGCTTCCAGG + Intergenic
953108005 3:39904552-39904574 CATTCTAAATACATGCTTTTGGG - Intronic
953546429 3:43866969-43866991 CATTTCAAACACATGCTGCTTGG + Intergenic
956657576 3:71567251-71567273 CATGGTAAACACTTGATTCTTGG - Intronic
957066190 3:75524396-75524418 CATTGTCTACATATGCTTTTAGG + Intergenic
958028057 3:88072499-88072521 CCTTGTACATATCTGCTTCTTGG + Intronic
958070076 3:88598378-88598400 CATTGTCCACACTTGGTTCAGGG + Intergenic
959724734 3:109530648-109530670 CATTGTACACAAATGATCCTTGG - Intergenic
960168606 3:114432504-114432526 CATAGCACACACCTGCTTTTTGG - Intronic
963955696 3:151251236-151251258 CTTTCTACCCAGATGCTTCTTGG + Intronic
966107324 3:176351956-176351978 CATTTTACACATATGATTGTAGG - Intergenic
967680570 3:192357729-192357751 CATGGAACATACATTCTTCTGGG + Intronic
967876782 3:194272930-194272952 GATTGGACACACATGGTTGTGGG + Intergenic
969010795 4:4060477-4060499 CATTGTCTACATATGCTTTTAGG + Intergenic
969743266 4:9049414-9049436 CATTGTCTACATATGCTTTTAGG - Intergenic
970669573 4:18380568-18380590 TATTTTACACACCTGATTCTGGG - Intergenic
971454587 4:26832355-26832377 CATTGCAAACACATGCATGTTGG + Intergenic
975329694 4:73099627-73099649 CATTGGCCACACCTGCTGCTAGG - Intronic
976569900 4:86595231-86595253 CCTTACACACACATTCTTCTGGG - Intronic
977902790 4:102441982-102442004 CATTGTAGACGCATGGTTGTTGG - Intergenic
977907821 4:102498884-102498906 CACTGTACAAACCTGCTTCCAGG - Intergenic
978523028 4:109636159-109636181 CATAGTACAGACATGGTTTTGGG + Intronic
978593753 4:110354837-110354859 CAATGTACACACTTTGTTCTAGG + Intergenic
982562689 4:156949565-156949587 CTTTGCACAGACATTCTTCTGGG - Intronic
983885225 4:172974049-172974071 CAAAGTATACACATGCTTTTTGG + Intronic
984843562 4:184091038-184091060 CATTGTAAATACATTATTCTTGG - Exonic
986396861 5:7339630-7339652 CATTGTACAAAAATGTTTCAAGG + Intergenic
986418705 5:7554597-7554619 CACTGAACAGACATGCTTTTTGG - Intronic
991560159 5:67942510-67942532 CATTTAACACACTTGCTTGTTGG - Intergenic
992830057 5:80585271-80585293 CACTGTACACACAGGCTTCTGGG - Intergenic
996636829 5:125700867-125700889 GATTATACACACAGTCTTCTGGG - Intergenic
996638749 5:125728145-125728167 GAATGTACACACATGCTGTTAGG - Intergenic
997552324 5:134764237-134764259 CTTTGTAGGCACATCCTTCTGGG - Intronic
999848843 5:155515534-155515556 CATTGTCCACCCAAGCTTCTGGG - Intergenic
1001615802 5:173042628-173042650 CACTCTACACACATTCTTCCTGG - Intergenic
1004778759 6:18881412-18881434 CCTTGTACACACACATTTCTAGG - Intergenic
1004961173 6:20790671-20790693 CAGTGTAAGCTCATGCTTCTTGG - Intronic
1005774337 6:29114257-29114279 CATTTTACATACATTATTCTTGG - Intergenic
1007800253 6:44386356-44386378 CATAGTACACACATATTTATGGG - Intergenic
1009044813 6:58225699-58225721 CATTGAACACACATGGTTATTGG - Intergenic
1011976468 6:93306351-93306373 CTTTGTGCAAACATGATTCTTGG - Intronic
1015375804 6:132508810-132508832 CATTCTTCACACATGATTCCTGG - Intronic
1020929721 7:14377684-14377706 CATTGTTCCCACAGGCATCTTGG - Intronic
1023366881 7:39473621-39473643 CATTGTACACATGTCCTTTTGGG + Intronic
1028428665 7:90721179-90721201 CTTTCTACACTCATGCTGCTTGG + Intronic
1031582725 7:123497119-123497141 GATCGTACAAACATCCTTCTGGG - Intronic
1034108238 7:148510366-148510388 CATTGGACACATATTTTTCTAGG + Intergenic
1041367334 8:57122006-57122028 GATTGCAAACACAGGCTTCTGGG + Intergenic
1041886098 8:62809538-62809560 CTTCATACACACATGCTTTTGGG - Intronic
1042232650 8:66574479-66574501 AATTGTGCACCCATGCTTCAGGG - Intronic
1043684436 8:83068693-83068715 CATTGTACACACATATGTCATGG + Intergenic
1046360402 8:113146262-113146284 CAATGTAACCACATGCTTCATGG + Intronic
1047364565 8:124200364-124200386 CCTTGTCCACACAGGCTTCAGGG - Intergenic
1048073772 8:131046621-131046643 CATTTAACCCACATCCTTCTTGG + Intergenic
1049497254 8:142942036-142942058 CAGTGTGCACACAGGCTTCAAGG + Intergenic
1052366933 9:27622478-27622500 CATTATACATACATGCATATAGG + Intergenic
1055433394 9:76267925-76267947 AAATGCACACACATGCTTATGGG + Intronic
1057447192 9:95124863-95124885 AATAGTAGACAGATGCTTCTGGG + Intronic
1057592614 9:96385329-96385351 GATTGTATACACATACTTCCAGG + Intergenic
1058640742 9:107081930-107081952 CATTTTACAGATATGCCTCTTGG - Intergenic
1059240960 9:112804912-112804934 CATTGTACACACATGCTTCTTGG - Exonic
1203519852 Un_GL000213v1:35011-35033 CACAGCACACACATGCTCCTGGG - Intergenic
1187397009 X:18927526-18927548 CATTGTACTCACAGGCTAGTGGG + Intronic
1188013808 X:25085818-25085840 CCTTGAACACACAGGCTTCTTGG - Intergenic
1188907681 X:35808047-35808069 CATGGCACATACATGCTACTGGG - Intergenic
1195714905 X:107809272-107809294 CCTTGCACCCACATGCCTCTCGG + Intergenic
1195747438 X:108132679-108132701 CCTTGTTTATACATGCTTCTTGG + Intronic
1197520797 X:127494072-127494094 AATTGTACAAAAATGTTTCTAGG + Intergenic
1198473734 X:136975164-136975186 CATTGTACAAAAATGTTTATAGG - Intergenic