ID: 1059246764

View in Genome Browser
Species Human (GRCh38)
Location 9:112855834-112855856
Sequence AGGGGCTGGCTGCCTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059246759_1059246764 22 Left 1059246759 9:112855789-112855811 CCATGTTAATTGTGAGGTTGGAG 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1059246764 9:112855834-112855856 AGGGGCTGGCTGCCTTCTCCTGG No data
1059246756_1059246764 28 Left 1059246756 9:112855783-112855805 CCTTCTCCATGTTAATTGTGAGG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1059246764 9:112855834-112855856 AGGGGCTGGCTGCCTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059246764 Original CRISPR AGGGGCTGGCTGCCTTCTCC TGG Intronic
No off target data available for this crispr