ID: 1059247866

View in Genome Browser
Species Human (GRCh38)
Location 9:112863706-112863728
Sequence TGGGGTTCAGAGGAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059247863_1059247866 -6 Left 1059247863 9:112863689-112863711 CCAGTTTATTTATGATGTGGGGT 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1059247866 9:112863706-112863728 TGGGGTTCAGAGGAGGCAGCTGG No data
1059247859_1059247866 -3 Left 1059247859 9:112863686-112863708 CCTCCAGTTTATTTATGATGTGG 0: 1
1: 0
2: 0
3: 8
4: 165
Right 1059247866 9:112863706-112863728 TGGGGTTCAGAGGAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059247866 Original CRISPR TGGGGTTCAGAGGAGGCAGC TGG Intronic
No off target data available for this crispr