ID: 1059254795

View in Genome Browser
Species Human (GRCh38)
Location 9:112919893-112919915
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059254795_1059254799 22 Left 1059254795 9:112919893-112919915 CCCAGATGAATGTGACCAACTTG No data
Right 1059254799 9:112919938-112919960 CCCTGAGCTCATCTTCCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059254795 Original CRISPR CAAGTTGGTCACATTCATCT GGG (reversed) Intergenic
No off target data available for this crispr