ID: 1059254955

View in Genome Browser
Species Human (GRCh38)
Location 9:112921446-112921468
Sequence TTCAAAGCATAAATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059254950_1059254955 23 Left 1059254950 9:112921400-112921422 CCAAAGCCTCAGATGCTATCAGA No data
Right 1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG No data
1059254951_1059254955 17 Left 1059254951 9:112921406-112921428 CCTCAGATGCTATCAGATGAATT No data
Right 1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059254955 Original CRISPR TTCAAAGCATAAATGGAGGA TGG Intergenic
No off target data available for this crispr