ID: 1059256504

View in Genome Browser
Species Human (GRCh38)
Location 9:112935865-112935887
Sequence CAGCAGCTCTAAAAGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059256496_1059256504 28 Left 1059256496 9:112935814-112935836 CCACCAAATGCAGAGGAGAATGG No data
Right 1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG No data
1059256495_1059256504 29 Left 1059256495 9:112935813-112935835 CCCACCAAATGCAGAGGAGAATG No data
Right 1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG No data
1059256502_1059256504 -5 Left 1059256502 9:112935847-112935869 CCAGCAAGTTCAGATGACCAGCA No data
Right 1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG No data
1059256498_1059256504 25 Left 1059256498 9:112935817-112935839 CCAAATGCAGAGGAGAATGGCTG No data
Right 1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059256504 Original CRISPR CAGCAGCTCTAAAAGACAAA AGG Intergenic
No off target data available for this crispr