ID: 1059256826

View in Genome Browser
Species Human (GRCh38)
Location 9:112938513-112938535
Sequence ATGGAGAAACAGTCTTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059256826_1059256828 -8 Left 1059256826 9:112938513-112938535 CCCTTCTAAGACTGTTTCTCCAT No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256826_1059256831 27 Left 1059256826 9:112938513-112938535 CCCTTCTAAGACTGTTTCTCCAT No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data
1059256826_1059256832 30 Left 1059256826 9:112938513-112938535 CCCTTCTAAGACTGTTTCTCCAT No data
Right 1059256832 9:112938566-112938588 TTTTCCCTAAGCCAAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059256826 Original CRISPR ATGGAGAAACAGTCTTAGAA GGG (reversed) Intergenic
No off target data available for this crispr