ID: 1059256828

View in Genome Browser
Species Human (GRCh38)
Location 9:112938528-112938550
Sequence TTCTCCATAGATTCTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059256822_1059256828 26 Left 1059256822 9:112938479-112938501 CCTGCCTGGAAGATTGACTTTAT No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256827_1059256828 -9 Left 1059256827 9:112938514-112938536 CCTTCTAAGACTGTTTCTCCATA No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256825_1059256828 -7 Left 1059256825 9:112938512-112938534 CCCCTTCTAAGACTGTTTCTCCA No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256823_1059256828 22 Left 1059256823 9:112938483-112938505 CCTGGAAGATTGACTTTATCAGC No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256821_1059256828 27 Left 1059256821 9:112938478-112938500 CCCTGCCTGGAAGATTGACTTTA No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256824_1059256828 -6 Left 1059256824 9:112938511-112938533 CCCCCTTCTAAGACTGTTTCTCC No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data
1059256826_1059256828 -8 Left 1059256826 9:112938513-112938535 CCCTTCTAAGACTGTTTCTCCAT No data
Right 1059256828 9:112938528-112938550 TTCTCCATAGATTCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059256828 Original CRISPR TTCTCCATAGATTCTTCCTC AGG Intergenic
No off target data available for this crispr