ID: 1059256831

View in Genome Browser
Species Human (GRCh38)
Location 9:112938563-112938585
Sequence TTATTTTCCCTAAGCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059256824_1059256831 29 Left 1059256824 9:112938511-112938533 CCCCCTTCTAAGACTGTTTCTCC No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data
1059256829_1059256831 8 Left 1059256829 9:112938532-112938554 CCATAGATTCTTCCTCAGGTTAT No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data
1059256825_1059256831 28 Left 1059256825 9:112938512-112938534 CCCCTTCTAAGACTGTTTCTCCA No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data
1059256830_1059256831 -4 Left 1059256830 9:112938544-112938566 CCTCAGGTTATTTATGAGCTTAT No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data
1059256826_1059256831 27 Left 1059256826 9:112938513-112938535 CCCTTCTAAGACTGTTTCTCCAT No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data
1059256827_1059256831 26 Left 1059256827 9:112938514-112938536 CCTTCTAAGACTGTTTCTCCATA No data
Right 1059256831 9:112938563-112938585 TTATTTTCCCTAAGCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059256831 Original CRISPR TTATTTTCCCTAAGCCAAAA AGG Intergenic
No off target data available for this crispr