ID: 1059260450

View in Genome Browser
Species Human (GRCh38)
Location 9:112971049-112971071
Sequence CTGCTTTCCCAGAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059260450_1059260453 24 Left 1059260450 9:112971049-112971071 CCATTTTTCTTCTGGGAAAGCAG No data
Right 1059260453 9:112971096-112971118 ATATTAAAAACTAGCAAAGCGGG No data
1059260450_1059260452 23 Left 1059260450 9:112971049-112971071 CCATTTTTCTTCTGGGAAAGCAG No data
Right 1059260452 9:112971095-112971117 TATATTAAAAACTAGCAAAGCGG No data
1059260450_1059260454 25 Left 1059260450 9:112971049-112971071 CCATTTTTCTTCTGGGAAAGCAG No data
Right 1059260454 9:112971097-112971119 TATTAAAAACTAGCAAAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059260450 Original CRISPR CTGCTTTCCCAGAAGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr