ID: 1059262645

View in Genome Browser
Species Human (GRCh38)
Location 9:112993516-112993538
Sequence GATCCCATGCCTCCTGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262645_1059262655 24 Left 1059262645 9:112993516-112993538 CCCCAGTCAGGAGGCATGGGATC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262645_1059262654 21 Left 1059262645 9:112993516-112993538 CCCCAGTCAGGAGGCATGGGATC No data
Right 1059262654 9:112993560-112993582 CTCTAGCTGCCCCTTGGCAGAGG No data
1059262645_1059262653 15 Left 1059262645 9:112993516-112993538 CCCCAGTCAGGAGGCATGGGATC No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262645 Original CRISPR GATCCCATGCCTCCTGACTG GGG (reversed) Intergenic
No off target data available for this crispr