ID: 1059262646

View in Genome Browser
Species Human (GRCh38)
Location 9:112993517-112993539
Sequence GGATCCCATGCCTCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262646_1059262654 20 Left 1059262646 9:112993517-112993539 CCCAGTCAGGAGGCATGGGATCC No data
Right 1059262654 9:112993560-112993582 CTCTAGCTGCCCCTTGGCAGAGG No data
1059262646_1059262655 23 Left 1059262646 9:112993517-112993539 CCCAGTCAGGAGGCATGGGATCC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262646_1059262653 14 Left 1059262646 9:112993517-112993539 CCCAGTCAGGAGGCATGGGATCC No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262646 Original CRISPR GGATCCCATGCCTCCTGACT GGG (reversed) Intergenic