ID: 1059262647

View in Genome Browser
Species Human (GRCh38)
Location 9:112993518-112993540
Sequence TGGATCCCATGCCTCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262647_1059262654 19 Left 1059262647 9:112993518-112993540 CCAGTCAGGAGGCATGGGATCCA No data
Right 1059262654 9:112993560-112993582 CTCTAGCTGCCCCTTGGCAGAGG No data
1059262647_1059262655 22 Left 1059262647 9:112993518-112993540 CCAGTCAGGAGGCATGGGATCCA No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262647_1059262653 13 Left 1059262647 9:112993518-112993540 CCAGTCAGGAGGCATGGGATCCA No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262647 Original CRISPR TGGATCCCATGCCTCCTGAC TGG (reversed) Intergenic