ID: 1059262651

View in Genome Browser
Species Human (GRCh38)
Location 9:112993545-112993567
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262651_1059262661 12 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262661 9:112993580-112993602 AGGAGGTGTGCTATGCTGGGTGG No data
1059262651_1059262654 -8 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262654 9:112993560-112993582 CTCTAGCTGCCCCTTGGCAGAGG No data
1059262651_1059262655 -5 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262651_1059262659 8 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262659 9:112993576-112993598 GCAGAGGAGGTGTGCTATGCTGG No data
1059262651_1059262660 9 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262660 9:112993577-112993599 CAGAGGAGGTGTGCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262651 Original CRISPR AGCTAGAGTGATTTGTTAGG TGG (reversed) Intergenic