ID: 1059262652

View in Genome Browser
Species Human (GRCh38)
Location 9:112993548-112993570
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262652_1059262661 9 Left 1059262652 9:112993548-112993570 CCTAACAAATCACTCTAGCTGCC No data
Right 1059262661 9:112993580-112993602 AGGAGGTGTGCTATGCTGGGTGG No data
1059262652_1059262655 -8 Left 1059262652 9:112993548-112993570 CCTAACAAATCACTCTAGCTGCC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262652_1059262659 5 Left 1059262652 9:112993548-112993570 CCTAACAAATCACTCTAGCTGCC No data
Right 1059262659 9:112993576-112993598 GCAGAGGAGGTGTGCTATGCTGG No data
1059262652_1059262660 6 Left 1059262652 9:112993548-112993570 CCTAACAAATCACTCTAGCTGCC No data
Right 1059262660 9:112993577-112993599 CAGAGGAGGTGTGCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262652 Original CRISPR GGCAGCTAGAGTGATTTGTT AGG (reversed) Intergenic