ID: 1059262653

View in Genome Browser
Species Human (GRCh38)
Location 9:112993554-112993576
Sequence AAATCACTCTAGCTGCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262649_1059262653 -7 Left 1059262649 9:112993538-112993560 CCAGGACCCACCTAACAAATCAC No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data
1059262647_1059262653 13 Left 1059262647 9:112993518-112993540 CCAGTCAGGAGGCATGGGATCCA No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data
1059262646_1059262653 14 Left 1059262646 9:112993517-112993539 CCCAGTCAGGAGGCATGGGATCC No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data
1059262645_1059262653 15 Left 1059262645 9:112993516-112993538 CCCCAGTCAGGAGGCATGGGATC No data
Right 1059262653 9:112993554-112993576 AAATCACTCTAGCTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262653 Original CRISPR AAATCACTCTAGCTGCCCCT TGG Intergenic
No off target data available for this crispr