ID: 1059262655

View in Genome Browser
Species Human (GRCh38)
Location 9:112993563-112993585
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262649_1059262655 2 Left 1059262649 9:112993538-112993560 CCAGGACCCACCTAACAAATCAC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262650_1059262655 -4 Left 1059262650 9:112993544-112993566 CCCACCTAACAAATCACTCTAGC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262647_1059262655 22 Left 1059262647 9:112993518-112993540 CCAGTCAGGAGGCATGGGATCCA No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262652_1059262655 -8 Left 1059262652 9:112993548-112993570 CCTAACAAATCACTCTAGCTGCC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262645_1059262655 24 Left 1059262645 9:112993516-112993538 CCCCAGTCAGGAGGCATGGGATC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262651_1059262655 -5 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data
1059262646_1059262655 23 Left 1059262646 9:112993517-112993539 CCCAGTCAGGAGGCATGGGATCC No data
Right 1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262655 Original CRISPR TAGCTGCCCCTTGGCAGAGG AGG Intergenic