ID: 1059262660

View in Genome Browser
Species Human (GRCh38)
Location 9:112993577-112993599
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059262650_1059262660 10 Left 1059262650 9:112993544-112993566 CCCACCTAACAAATCACTCTAGC No data
Right 1059262660 9:112993577-112993599 CAGAGGAGGTGTGCTATGCTGGG No data
1059262652_1059262660 6 Left 1059262652 9:112993548-112993570 CCTAACAAATCACTCTAGCTGCC No data
Right 1059262660 9:112993577-112993599 CAGAGGAGGTGTGCTATGCTGGG No data
1059262651_1059262660 9 Left 1059262651 9:112993545-112993567 CCACCTAACAAATCACTCTAGCT No data
Right 1059262660 9:112993577-112993599 CAGAGGAGGTGTGCTATGCTGGG No data
1059262649_1059262660 16 Left 1059262649 9:112993538-112993560 CCAGGACCCACCTAACAAATCAC No data
Right 1059262660 9:112993577-112993599 CAGAGGAGGTGTGCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059262660 Original CRISPR CAGAGGAGGTGTGCTATGCT GGG Intergenic
No off target data available for this crispr