ID: 1059263579

View in Genome Browser
Species Human (GRCh38)
Location 9:113004063-113004085
Sequence CCTTTTAAGAAGACGGTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059263573_1059263579 -1 Left 1059263573 9:113004041-113004063 CCTAATCCAGTATGGCTGGTGCC No data
Right 1059263579 9:113004063-113004085 CCTTTTAAGAAGACGGTCACGGG No data
1059263574_1059263579 -7 Left 1059263574 9:113004047-113004069 CCAGTATGGCTGGTGCCCTTTTA No data
Right 1059263579 9:113004063-113004085 CCTTTTAAGAAGACGGTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059263579 Original CRISPR CCTTTTAAGAAGACGGTCAC GGG Intergenic
No off target data available for this crispr