ID: 1059270466

View in Genome Browser
Species Human (GRCh38)
Location 9:113067532-113067554
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1059270463_1059270466 0 Left 1059270463 9:113067509-113067531 CCTGTGTGTGTGTGTGTGTGTGT No data
Right 1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG No data
1059270462_1059270466 16 Left 1059270462 9:113067493-113067515 CCTGCGTGTGTGCGTGCCTGTGT No data
Right 1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG No data
1059270461_1059270466 27 Left 1059270461 9:113067482-113067504 CCTGGTGTGCACCTGCGTGTGTG No data
Right 1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1059270466 Original CRISPR GTGCGCGCGCGCGCGTGCTG GGG Intergenic